ID: 996796154

View in Genome Browser
Species Human (GRCh38)
Location 5:127350636-127350658
Sequence AATGAAATACAAACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 411}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996796154 Original CRISPR AATGAAATACAAACTGTGGA AGG Intronic
901183863 1:7359583-7359605 AGTGAAACACAAACTGCAGAAGG - Intronic
901262605 1:7885158-7885180 AATGAAATAAAAGTTGTGGATGG - Intergenic
903859796 1:26357672-26357694 AAGGAAAAACATCCTGTGGAAGG - Intergenic
905899451 1:41571648-41571670 AAAGAACTACAGAGTGTGGAGGG + Intronic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908571465 1:65415769-65415791 AATGAAACACAGTCTGTGTAGGG + Intronic
908866049 1:68549443-68549465 AATGAAAGACAAAATGTTAAGGG + Intergenic
908986947 1:70035834-70035856 AAAGAAAGACAAAATGTGGCTGG - Intronic
911123504 1:94319194-94319216 AAAGAGAAAGAAACTGTGGAGGG - Intergenic
911148895 1:94578516-94578538 AATGAAATAAAAAATGTTAAGGG - Intergenic
911310554 1:96287752-96287774 AATGAAAGACAAAATGTTAAAGG - Intergenic
911828852 1:102524720-102524742 AATGTAATACAAATTTTGGCCGG + Intergenic
915150750 1:153829395-153829417 AATGAAATTGAAACTTGGGAAGG - Intronic
916633238 1:166639035-166639057 AATGAAAGAAAAAATGTTGAAGG + Intergenic
917221927 1:172741037-172741059 AATGAAAAACATAATGTGTAGGG - Intergenic
917338954 1:173954700-173954722 AATGACATAAAAAATTTGGACGG + Intronic
919391891 1:196995848-196995870 AAGAAAATACAATGTGTGGATGG + Exonic
919994093 1:202731814-202731836 AACAAAATACAAACCATGGAGGG + Exonic
920328500 1:205186372-205186394 AAAGAAATATGGACTGTGGAAGG + Intronic
920455273 1:206096439-206096461 AAAGAAATGAAAATTGTGGAAGG - Intronic
920964457 1:210690565-210690587 ACTGAAAAACAAACTGCAGATGG + Intronic
921745423 1:218735026-218735048 AATGAAACACAAAATATGAAAGG + Intergenic
921767431 1:218989083-218989105 AATGAAATAAAAAATGTTAAAGG - Intergenic
921859357 1:220025614-220025636 TATTAAAGACAAACAGTGGAAGG - Intronic
921942636 1:220858763-220858785 AAAGAAAGACAAACTATGAAAGG - Intergenic
923638004 1:235720604-235720626 AAAGAAATACAACATATGGATGG + Intronic
923889865 1:238201942-238201964 ACTGAAATACAAACTTGGGTGGG - Intergenic
924296639 1:242593433-242593455 AATAAAATACAAACTGCCAATGG + Intergenic
924491577 1:244543149-244543171 AATGGAAATCAATCTGTGGAAGG + Intronic
924629744 1:245725408-245725430 AATGAAAGACAAAATGTTAAGGG + Intergenic
924886835 1:248227943-248227965 AATGAAATAAAAAATGTTAAAGG - Intergenic
1063312699 10:4969532-4969554 GATGAAATCCACACTGAGGAAGG + Intronic
1063315240 10:4998015-4998037 GATGAAATCCACACTGAGGAAGG - Intronic
1063700046 10:8375639-8375661 AATGAAATAAAAAATGTATATGG + Intergenic
1063797729 10:9532044-9532066 ATTAAAACACATACTGTGGAAGG + Intergenic
1064735333 10:18376491-18376513 AAAGAAACACAAAATGTGGCTGG + Intronic
1064816572 10:19271805-19271827 AATGAAATAGAAACTGTGAGAGG + Intronic
1064848810 10:19686744-19686766 AATGCTATACAATTTGTGGAGGG + Intronic
1064965137 10:21007524-21007546 AATGAAATAGAAAGAATGGAAGG - Intronic
1065331769 10:24609225-24609247 AGTGAAATTCAAATTGTGCATGG + Intronic
1066414617 10:35209285-35209307 AAAGAAATAAAAACTGTTGCTGG - Intronic
1067192778 10:44085193-44085215 AATCAAATACAGACTGAGTATGG - Intergenic
1067675357 10:48370488-48370510 CATGGAATATAAGCTGTGGAAGG + Intronic
1068442304 10:57073487-57073509 AATGAAATACAAATTGAAGCAGG + Intergenic
1068698865 10:59999018-59999040 AAGGAAATACGAACTAGGGAGGG - Intergenic
1068834729 10:61541584-61541606 AATAAATTACAAATAGTGGAAGG + Intergenic
1069340687 10:67404779-67404801 AATGAAATAAAAAATGTCAAAGG + Intronic
1070375534 10:75827423-75827445 AAGAAAATACAAACAGAGGATGG - Intronic
1072128001 10:92464666-92464688 AAAGAAAATCAAACTGTGAATGG - Intronic
1073192066 10:101658568-101658590 AATGAAAAAGAAAATGAGGAAGG + Intronic
1073955391 10:108864854-108864876 AATGAAATAAAATCTGTGGTTGG + Intergenic
1074358936 10:112809792-112809814 AAAGAAATTCGGACTGTGGAAGG + Intronic
1074413055 10:113244178-113244200 GATGAAATAAAAACCGGGGATGG - Intergenic
1075760866 10:124855237-124855259 AATGAAATAAGAAATGTGGTTGG - Intergenic
1076030235 10:127151317-127151339 AATGAAATAAAGACTTTGGGAGG + Intronic
1076067509 10:127460424-127460446 CATGAAAAGCAAACTTTGGAAGG + Intergenic
1076463874 10:130665279-130665301 TGTGAAATCCAAACTGTGAAGGG - Intergenic
1077128257 11:954769-954791 AATTAAAAGCAAGCTGTGGATGG + Intronic
1078501837 11:11886810-11886832 AATGAAATAAAAAATGTTAAGGG + Intronic
1078554787 11:12314202-12314224 AATGAAAAACAAACAGTAAACGG - Intronic
1079611258 11:22435436-22435458 AATAAAATACACACTTTGGGAGG + Intergenic
1079717084 11:23761674-23761696 AATGAAATAATAACTGTAAATGG + Intergenic
1079906558 11:26255408-26255430 GATTAAATACACACTGTGTATGG + Intergenic
1080191165 11:29550954-29550976 ATTGAGTTACAAACTATGGAGGG - Intergenic
1080466353 11:32501124-32501146 AATAGAAAACAAACTGTGGATGG + Intergenic
1080498384 11:32844872-32844894 AAAGAAATACAAATATTGGATGG - Intronic
1080513602 11:32999878-32999900 AATGAAAGAAAAACTGTTAAGGG - Intergenic
1080911848 11:36608581-36608603 AATGAAGTCCAAACTGTGCTTGG + Intronic
1081454779 11:43211118-43211140 AATGAAAGAAAAACTGTTAAGGG - Intergenic
1082659800 11:55895656-55895678 ACTGGAATTCAAACTGTGGTGGG + Intergenic
1082916506 11:58443970-58443992 AGTGAAATAAAAAATGTGGGAGG + Intergenic
1084930155 11:72548884-72548906 AATGAAATCCAAAATGGAGATGG - Intergenic
1087235462 11:95713179-95713201 AATAAAATAAAAACAGTGGGTGG - Intergenic
1087505086 11:99010524-99010546 AATGAACTAAAAAATGTGGCTGG - Intergenic
1088585456 11:111356774-111356796 AATGAAATAATGAGTGTGGAGGG - Intronic
1089139579 11:116275093-116275115 AATACATTACAAACTGAGGAAGG - Intergenic
1090106306 11:123856354-123856376 AATGAAAGAAAAACTGTTAAGGG + Intergenic
1090342700 11:126039391-126039413 AATGAAATACCAATAGTAGATGG - Intronic
1090508445 11:127345207-127345229 AATGAAAAACAGAGTATGGATGG - Intergenic
1090605312 11:128416919-128416941 AATGAAATACAAACACAGGGTGG + Intergenic
1090684684 11:129101923-129101945 AATGAAAGAAAAAATGTGAAAGG + Intronic
1093367002 12:18314783-18314805 AATGAAATAGAAAATGTAAAGGG + Intronic
1093775219 12:23065714-23065736 AGTAAAACACATACTGTGGAAGG + Intergenic
1094217753 12:27962840-27962862 AATTAAATAAAAAGTGTGAATGG + Intronic
1094298798 12:28937916-28937938 AATGATATAAAAACTGGAGAAGG - Intergenic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1097520058 12:60656161-60656183 ACTGGAAGACAAACTGTGGTAGG - Intergenic
1098152620 12:67563062-67563084 TATGAAATACAAACCTTGAAAGG - Intergenic
1098664422 12:73143556-73143578 AATAAAAGAAAAACTGTAGAAGG - Intergenic
1099745150 12:86692388-86692410 AATGTAATACAAAATGTGTAAGG + Intronic
1099851287 12:88100379-88100401 AAGGAAATACAAAAACTGGATGG - Intronic
1100028289 12:90154897-90154919 AATGAAGTAAAAACTGTTAAGGG + Intergenic
1100221554 12:92509578-92509600 AAGGAAATACAGTCTGTGGCTGG + Intergenic
1100361695 12:93885331-93885353 AAAGAAATACAAACACAGGAGGG + Intronic
1100944930 12:99771207-99771229 AAAGAAATTCAAATTGAGGAAGG - Intronic
1101737294 12:107472598-107472620 AATGAAATACTACCTGAGAAAGG + Intronic
1103383989 12:120517372-120517394 AATAAAATAAAAACTGAGGCCGG + Intronic
1104529333 12:129554116-129554138 TAAGGAATAGAAACTGTGGAAGG - Intronic
1105542016 13:21324126-21324148 AATGAAATAATAAATGTGGAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105914350 13:24898761-24898783 ATTAAAATACAGACAGTGGAAGG + Intronic
1105968107 13:25403113-25403135 ATTTCAATACGAACTGTGGAGGG + Intronic
1106908638 13:34438667-34438689 TAGGAAACACACACTGTGGAAGG - Intergenic
1107235182 13:38160042-38160064 AATTAAAAACACACAGTGGAGGG - Intergenic
1107465850 13:40649512-40649534 AATCAAAGACAAACTGTTGATGG - Intronic
1107718048 13:43220043-43220065 AGAGAAATACAAAATGTAGATGG + Intronic
1109174280 13:59135936-59135958 AATGAGAGAGAAACAGTGGAAGG - Intergenic
1109763882 13:66866953-66866975 AACCAAACACTAACTGTGGATGG + Intronic
1109775914 13:67040699-67040721 ATTGAAATACAGAATGTGGTGGG + Intronic
1110102048 13:71618653-71618675 AATTACATAAAAACTGGGGAAGG + Intronic
1110499727 13:76213162-76213184 AATGAAACAAAAAAAGTGGATGG + Intergenic
1110658513 13:78029755-78029777 TTTGAAATACAAACTTGGGATGG - Intergenic
1111876751 13:93906649-93906671 TAAGAAATACAAAATGTAGAGGG + Intronic
1113281137 13:108789166-108789188 TATGAAATACACACAGTGAAAGG - Intronic
1114706145 14:24728236-24728258 AATGAAAGAAAAACTGTTAAGGG + Intergenic
1115681285 14:35741119-35741141 ATTGAAAAACAAACAATGGAAGG - Intronic
1116504687 14:45664222-45664244 AATGAAAGAAAAAATGTGAAAGG - Intergenic
1116799824 14:49430956-49430978 AATGAAAGAAAAAATGTTGAAGG + Intergenic
1117294503 14:54366702-54366724 AATGAAATAGAAACTGTCTCAGG + Intergenic
1119231163 14:72980909-72980931 ACTGAATTAGAAACTGTGGAGGG + Intronic
1120587134 14:86326758-86326780 AATTAAATACAGTCTTTGGATGG - Intergenic
1121420956 14:93813770-93813792 AATGAAATACATTCACTGGATGG + Intergenic
1124628378 15:31323527-31323549 AAAGACATACAACCTGTGAAGGG - Intergenic
1126677051 15:51169500-51169522 AAAGTAATACAAACTGTTCAAGG + Intergenic
1127021904 15:54757546-54757568 AATGAAAGAAAAAATGTTGAAGG + Intergenic
1127274249 15:57428234-57428256 AATTAAATACAAACTGTGGGAGG + Intronic
1127891658 15:63257561-63257583 ATTGAAAAACAAAATGTGGCTGG - Intronic
1129584821 15:76851407-76851429 AATGAAAGAAAAAATGTTGAAGG + Intronic
1131626554 15:94126681-94126703 AATGAAATACAAAAGCTGAATGG - Intergenic
1131656891 15:94470392-94470414 AATGAAATACAAAATGATGGTGG - Exonic
1131662034 15:94527762-94527784 AATCAAATACAAAGACTGGAGGG + Intergenic
1131723420 15:95196576-95196598 AATAAAATAAAAACTGGGGGTGG + Intergenic
1132205999 15:99986673-99986695 AATGAAAAACACATTCTGGAGGG - Intronic
1132411222 15:101579446-101579468 AAGGAAACACAAAGTGGGGAAGG + Intergenic
1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG + Intronic
1136077897 16:27829361-27829383 AATGTTCTACAAACTGTGGGAGG + Intronic
1136136783 16:28260998-28261020 AATAAGAAACAAAGTGTGGATGG + Intergenic
1136552331 16:30988325-30988347 AAAGAAAAAGAAAATGTGGAGGG - Exonic
1140145517 16:72303235-72303257 ACTGGAATATAAACTCTGGAAGG - Intergenic
1140706591 16:77636333-77636355 AATGAACTATAAACTCTGGGAGG + Intergenic
1142974059 17:3632797-3632819 AAATAAATATAAACTGTGAAAGG + Intronic
1143767127 17:9145081-9145103 CATGAAATCCGAACTCTGGAGGG + Intronic
1147762168 17:42805928-42805950 AAGGCAATACAAAATGTGCATGG + Intronic
1148551659 17:48554260-48554282 AATGAAATAAAAACGTTGGAGGG + Intronic
1153406455 18:4746224-4746246 AGTGAAGCAGAAACTGTGGATGG - Intergenic
1153442435 18:5135005-5135027 AATAAAATACAAAATGGTGAAGG - Intergenic
1153750681 18:8227067-8227089 AATGAAATTAAAGCTGTGGTTGG - Intronic
1153867673 18:9287850-9287872 AATGAAATTCCAGCTGTGGCTGG - Intergenic
1154478535 18:14792387-14792409 AATGGAATAGAAATTGTAGACGG + Intronic
1154479483 18:14804722-14804744 AATGGAATAGAAATTGTAGATGG + Intronic
1155086316 18:22462749-22462771 AATAAAAAACAAACTGTGGCGGG - Intergenic
1155124037 18:22853736-22853758 AAAGAAAAAGAAAATGTGGAGGG - Intronic
1155593983 18:27461128-27461150 AAAGAACTAAAAGCTGTGGAAGG - Intergenic
1157023818 18:43818724-43818746 AAATAAATACAAACAATGGAGGG - Intergenic
1157111131 18:44821273-44821295 AATTAAATCCAAACTCTGGAAGG + Intronic
1157181204 18:45499836-45499858 AATGAAATAATGAATGTGGAGGG + Intronic
1157205314 18:45693037-45693059 AATGAAAAACAAAATGTTAAAGG + Intergenic
1157245107 18:46046745-46046767 AATGAAATGCAAACCATGGAGGG - Intronic
1157653198 18:49358332-49358354 AAAGGAAGACAAACTGTAGAAGG + Intronic
1158157578 18:54443148-54443170 AGTGAAATAGAAAATATGGAGGG - Intergenic
1159346545 18:67214092-67214114 AAGGAAATCCAATCTTTGGAAGG - Intergenic
1159392962 18:67818173-67818195 AATGAAATCCACATAGTGGAGGG - Intergenic
1159616522 18:70586418-70586440 CATCAAAAACAAAATGTGGAGGG + Intergenic
1162594645 19:11618394-11618416 AAGGAAAACCAAAGTGTGGATGG - Exonic
1163568461 19:18065881-18065903 AATAAAATATTAACTGTGCATGG + Intronic
1164261255 19:23570164-23570186 AATGAATTCCAAGCTCTGGAGGG + Intronic
1165207894 19:34206747-34206769 ACTGAAATACCAACTGTGACTGG + Intronic
1165336664 19:35175153-35175175 AGTGGACTACAAACTGTGGAAGG + Intergenic
1166086532 19:40479352-40479374 AGTGAGCCACAAACTGTGGAGGG - Intronic
1167788228 19:51653426-51653448 ACTGAAAGACAAACTTTGCATGG + Intergenic
1167924845 19:52813265-52813287 AAAAAAAGACATACTGTGGAAGG + Intronic
925689994 2:6511952-6511974 AATGAAACACAAACTTCAGAAGG - Intergenic
926368452 2:12155594-12155616 AACGAATAACAAATTGTGGAGGG - Intergenic
926987159 2:18637678-18637700 AATGAAATAAAAAATGTTAAGGG - Intergenic
927867846 2:26603324-26603346 AATGCAATACAAACTTTGCTCGG - Intronic
928903744 2:36349412-36349434 AATGAAATAATAAATGTGAAAGG + Intergenic
932637651 2:73406468-73406490 AATGAAAAACAAGCTATGAAAGG - Intronic
933601709 2:84338786-84338808 AAGGAATCACAAACTGTAGAAGG + Intergenic
933916968 2:87005220-87005242 ACTGAAATACAATCTGTGGTGGG - Intronic
934006027 2:87764694-87764716 ACTGAAATACAATCTGTGGTGGG + Intronic
934114606 2:88775111-88775133 AATGAAGAACAAAATGTGGAAGG + Intergenic
934632027 2:95936745-95936767 AATGAAGAACAAAATGTGGAAGG - Intronic
934801476 2:97166476-97166498 AATGAAGAACAAAATGTGGAAGG + Intronic
935011168 2:99137476-99137498 AATAAAATCCAAACTTTGTAAGG - Intronic
935382607 2:102467795-102467817 AAGGGAATACAAACTTTGCAAGG - Intergenic
935768982 2:106398796-106398818 ACTGAAATACAATCTGTGGTGGG + Intronic
935911116 2:107897129-107897151 ACTGAAATACAATCTGTGGTGGG - Intergenic
935969233 2:108513963-108513985 ACTGAAATACAATCTGTGGTGGG - Intergenic
936265528 2:111002750-111002772 AATAAAATAAAAAATATGGAGGG - Intronic
936648401 2:114398200-114398222 AAGCTAATACAAACTTTGGAAGG + Intergenic
937586586 2:123558860-123558882 AATGCTATAAAAACTCTGGAAGG - Intergenic
938394662 2:130934838-130934860 TAAGAAATACAAACTTTGGCCGG - Intronic
938837771 2:135124854-135124876 AATAAAATAGAGACTGTGCATGG + Intronic
939005618 2:136783443-136783465 ATTGAAATACAAACAGAAGATGG + Intronic
939365789 2:141229169-141229191 ATTGAAACACTTACTGTGGAAGG + Exonic
939596205 2:144126202-144126224 ACCAAATTACAAACTGTGGAAGG - Intronic
939718951 2:145623198-145623220 AATGAAATTTAAAATGTGAATGG - Intergenic
941444092 2:165579519-165579541 GATGAGATAGAAACTCTGGATGG - Intronic
941540884 2:166782637-166782659 AATGCAATTCAGACTTTGGAAGG - Intergenic
941572969 2:167194459-167194481 AATGAAATAAAAACGAAGGAAGG - Intronic
941829507 2:169939209-169939231 AATGAAATAGAAAATGGGGGTGG - Intronic
941981758 2:171465779-171465801 AATGAAATAGAAAATGGGGCTGG - Intronic
942329228 2:174804483-174804505 AGTGGAAAACAGACTGTGGAAGG + Intronic
942729394 2:179047066-179047088 AATGTGATAGAAACTATGGAAGG - Intronic
942794114 2:179795990-179796012 CATGAAACAGAAACTATGGAGGG + Intronic
943657021 2:190520762-190520784 AATGAAACACAATGTATGGAGGG - Intronic
943690000 2:190859960-190859982 AATAAAAAAAAAACTGTGGCTGG + Intergenic
943944536 2:194043009-194043031 AAATAAATAAAAACTGAGGAAGG - Intergenic
943996787 2:194778180-194778202 AATGAAATAAAAACACTGGAGGG + Intergenic
944679500 2:202064295-202064317 AATGAAATCCATATTGTGGAAGG - Intergenic
945096079 2:206220859-206220881 AATGAAACAAAAACTGCAGATGG - Intergenic
945560732 2:211336856-211336878 AGTGAAATAAGAACTGAGGAAGG - Intergenic
945978988 2:216293631-216293653 AATGAAAAACATAGTTTGGAGGG - Intronic
946045641 2:216818736-216818758 AAGGAACTATAAAGTGTGGATGG + Intergenic
947406138 2:229779577-229779599 AATAAAATACAAATAATGGAAGG + Intronic
947671514 2:231939493-231939515 TATTAAATATAAAATGTGGAAGG - Intergenic
947673743 2:231959778-231959800 ATTGAAATAAAATCTGTGGCCGG - Intergenic
948241979 2:236445734-236445756 AATGAAAAAAAAACTGTTGTAGG + Intronic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1169835293 20:9871333-9871355 AATAAAATACAAACTCTGTTTGG + Intergenic
1170755648 20:19204091-19204113 AAGAAAATACAACCTGTAGAGGG + Intergenic
1173352924 20:42261561-42261583 AATGAAATGCAAACTCTAAAAGG + Intronic
1175035981 20:56002624-56002646 ATTGAAATACAAACTAGGGGTGG + Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177561614 21:22762026-22762048 ATTAAAATACAAACTCTGGCCGG + Intergenic
1177827431 21:26100042-26100064 AATGAAAAACAAATTGTGGGTGG + Intronic
1179048467 21:37868189-37868211 AATGCAATAAATACGGTGGAGGG + Intronic
1179113063 21:38463833-38463855 ACTGAAAGTCAAACTCTGGACGG - Intronic
949134749 3:550700-550722 GATGAAATACAGAATGTTGATGG + Intergenic
950381646 3:12620454-12620476 AATTAAAAAGAAAGTGTGGATGG - Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951278440 3:20717796-20717818 ACTGAAATAGGAACTGAGGAAGG - Intergenic
951607209 3:24449109-24449131 AATGAAAGACAAAGTATGAAAGG + Intronic
952448863 3:33411867-33411889 AATGAAATACAAACCATGGTAGG - Intronic
952629970 3:35454476-35454498 AATGAAACACAAAATGTTAAAGG + Intergenic
952754033 3:36850315-36850337 AATGATACACTAATTGTGGAAGG + Intronic
953081695 3:39625689-39625711 AATGAAATGCCAAGTGTGGCTGG - Intergenic
953861400 3:46546865-46546887 AATGGGATATAAACTGTGGCAGG - Intronic
956827074 3:73007283-73007305 AAAGAACTTCAAACTGTAGAGGG - Intronic
957204529 3:77178654-77178676 AATTATATACACACTGTGGGGGG - Intronic
957521946 3:81329604-81329626 ACAGAAATAAAAACTGAGGATGG + Intergenic
957656025 3:83076738-83076760 AATATAATACAAACTATGCAGGG - Intergenic
958145401 3:89617151-89617173 AGTGAAATATAAACTGATGATGG - Intergenic
959208151 3:103340054-103340076 AATCAAATCATAACTGTGGAGGG - Intergenic
959753632 3:109869425-109869447 AATGGAACACAAATTGTGTAAGG + Intergenic
959989191 3:112611958-112611980 GATGAAATACAACCTCTGAATGG + Intronic
960473760 3:118098733-118098755 AATGAAATTCTAACTATGGAAGG - Intergenic
960612785 3:119570373-119570395 AATGAAATAGAAACTGAAAAGGG - Intergenic
962789460 3:138798024-138798046 AGTGAAAAACACACTGTGCAAGG + Intronic
963938734 3:151080361-151080383 CATGAAATGCAAAATGTGGCTGG + Intergenic
965372096 3:167875811-167875833 ATTGTCCTACAAACTGTGGATGG - Intergenic
965976415 3:174628913-174628935 AAATAAATACAAACTGTTCATGG - Intronic
966028401 3:175314819-175314841 AATGAAAAACATACTGTATATGG - Intronic
966224754 3:177585996-177586018 AATACATAACAAACTGTGGACGG - Intergenic
966418832 3:179717475-179717497 AATGGGTTACGAACTGTGGAGGG + Intronic
967301615 3:188019963-188019985 AAATAAATACACACTGTGGGAGG - Intergenic
968199796 3:196742380-196742402 ATTGAAATAGAAACTGTTGGTGG - Intronic
968217578 3:196906421-196906443 ATATAAATACAAACTGTGGTAGG - Intronic
971538556 4:27785955-27785977 AATGAAAAAAAACCTGTGAAGGG + Intergenic
971590100 4:28456439-28456461 AATGAAAGAAAAAATGTGAAGGG - Intergenic
971674539 4:29608946-29608968 AAAGAAATAAAAATTGTGAATGG - Intergenic
972255994 4:37356112-37356134 AATGAAATGCTAACTGTTGAAGG - Intronic
974178373 4:58354496-58354518 AATGTATTACAAACTTGGGAGGG - Intergenic
974439323 4:61896792-61896814 AAGGACATAAAAACTGTGGCAGG - Intronic
974717398 4:65686234-65686256 AATGAAATATCAACTAAGGAAGG + Intergenic
975899020 4:79128207-79128229 AATGAAATAAAAAATGTTAAAGG - Intergenic
975999701 4:80359243-80359265 AATGAAAGAAAAACTGTTAAGGG - Intronic
977234414 4:94490112-94490134 AATCAAATATGAACTGTGGGGGG + Intronic
977370808 4:96132623-96132645 GATGAAGTACAAATTGTGTAAGG - Intergenic
977508843 4:97936802-97936824 AATGAAAAACAAAATGTTAAGGG - Intronic
980243666 4:130208710-130208732 CATGAAACACAAAATGTGAAAGG + Intergenic
980493319 4:133559283-133559305 AATGAAATACAGAGTATGAATGG + Intergenic
980828881 4:138105567-138105589 AATGAAACAAAGACTGAGGAAGG + Intergenic
980829629 4:138114134-138114156 AATGAAATAAAACATATGGAAGG + Intergenic
980909081 4:138977724-138977746 AATAAATGACAAACTGAGGAGGG - Intergenic
981505115 4:145491270-145491292 AATGAAATGCCAACTGCTGACGG + Intronic
981566721 4:146109503-146109525 TATGAAATATAAACTGTTCATGG - Intergenic
983579654 4:169294850-169294872 AATGAAATACTTAGCGTGGATGG + Intergenic
983830965 4:172328312-172328334 AATGAAAGAAAAAATGTTGAAGG - Intronic
983868181 4:172792949-172792971 AATGACATACAAATTCTGAAAGG - Intronic
984228794 4:177068159-177068181 AAAGAAATAATAACTGTAGAAGG - Intergenic
984247563 4:177294100-177294122 AATTGAAAAAAAACTGTGGATGG - Intergenic
984513228 4:180704773-180704795 AGTTAAATACAAACTGTGCTTGG - Intergenic
985235099 4:187863852-187863874 AATGAAGTACAAGAAGTGGATGG + Intergenic
985942567 5:3150429-3150451 AATGGGAGACAAACTGTGTACGG + Intergenic
986300258 5:6472890-6472912 GATGAAATCCAAAATGTGAAAGG - Intronic
986357632 5:6944143-6944165 AATGAAATAACATTTGTGGAAGG + Intergenic
986376422 5:7136579-7136601 ACTGAAGAACAAACTGGGGATGG + Intergenic
986788121 5:11133957-11133979 AACCAAATACTAACTGGGGAAGG + Intronic
987451866 5:18094755-18094777 AATGTAATAGCAACTTTGGAAGG + Intergenic
988029718 5:25747999-25748021 AGTGATGTACAAACTGTGAATGG + Intergenic
988115095 5:26876696-26876718 AATGAAAAATAAAATGTGGCTGG - Intergenic
988663040 5:33294239-33294261 AACGAAAAAAAAACAGTGGATGG + Intergenic
988865158 5:35326073-35326095 AATGAAAGAAAAACTGTTAAAGG + Intergenic
988892019 5:35628217-35628239 GATGAAATACAAAATTTTGAAGG - Intronic
989545482 5:42667552-42667574 AATTAAATTAAACCTGTGGAAGG + Intronic
990183604 5:53189791-53189813 AATGAAAGAAAAACTGTTAAGGG - Intergenic
991233605 5:64366381-64366403 AATGAAATAAAAAGTGTTAAAGG - Intronic
992866656 5:80963001-80963023 AATGCAAGACAAAATGTGGAAGG - Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993778333 5:92031318-92031340 AATGCAAAGCAAATTGTGGAAGG - Intergenic
993788442 5:92174418-92174440 AATGAAAAACAAAATGTTTAAGG + Intergenic
996083622 5:119282310-119282332 TATGAAATAAATGCTGTGGAAGG + Intronic
996656707 5:125947238-125947260 AAATAAATACAAGCTGTGGTCGG + Intergenic
996796154 5:127350636-127350658 AATGAAATACAAACTGTGGAAGG + Intronic
997100737 5:130966159-130966181 AGTGAAAAGCAAACTGTAGAGGG + Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
997755906 5:136399379-136399401 AATGGAAGCCAAATTGTGGAAGG + Intergenic
998245128 5:140494348-140494370 AAAGAAATATAAATTGAGGAAGG + Intronic
998727305 5:145032190-145032212 AAAGAAATACAAACTTTCAATGG - Intergenic
999222985 5:149997039-149997061 TATGAAATATAAAATGTGGTGGG + Intronic
999475987 5:151899443-151899465 AATGAAAAAGAAATGGTGGATGG + Intronic
999913627 5:156233485-156233507 AAGGAAATACAAAGTGGAGAGGG + Intronic
999938829 5:156517835-156517857 AAGGAAGCACTAACTGTGGAAGG + Intronic
1000646549 5:163766773-163766795 AATGTATTACAAATTTTGGAAGG + Intergenic
1000871910 5:166587792-166587814 AAGGAAAAAAGAACTGTGGAAGG + Intergenic
1003410115 6:5854665-5854687 AATGAAATAGTAAAGGTGGAAGG + Intergenic
1004073681 6:12325850-12325872 AATGAAATACATAATTTGGTAGG - Intergenic
1006730420 6:36231807-36231829 AAGGAAAAAAAAACTGTGAATGG + Exonic
1006978630 6:38127230-38127252 AATCAACTACAACCTGTGGGGGG - Intronic
1007202973 6:40126217-40126239 AATGAAATATTAACAGTGGCAGG + Intergenic
1008845242 6:55955229-55955251 AATTTAATAGGAACTGTGGATGG - Intergenic
1009391976 6:63155497-63155519 AATAAAACAGAAATTGTGGAGGG + Intergenic
1009473918 6:64063609-64063631 AATGAAAAACAAAGTTTGAAAGG - Intronic
1009502676 6:64435566-64435588 AAAGAAATAAAAAAGGTGGAGGG + Intronic
1009548030 6:65047305-65047327 AACCAAATACAAAGTATGGATGG - Intronic
1010253462 6:73732203-73732225 AATGAATAACATAGTGTGGAAGG + Intronic
1010264952 6:73855856-73855878 AATGAAAAAGAACATGTGGAAGG - Intergenic
1010322941 6:74534181-74534203 AATGAACTACAAAAAGTGGTAGG + Intergenic
1010496135 6:76535569-76535591 AAAGAAATAAAAAGTGTGAAAGG - Intergenic
1011144622 6:84199576-84199598 AATGAAATGCAAGCTGCTGACGG + Intronic
1011416814 6:87130334-87130356 AAAAAAATACAAAATGTGGCAGG - Intergenic
1011863433 6:91790030-91790052 AATGACATTCACACAGTGGATGG + Intergenic
1012334225 6:98034372-98034394 AATGACATAAAATCTGTGTATGG - Intergenic
1012466894 6:99525598-99525620 ACTGAAATAAAAAGTGTTGATGG - Intergenic
1012869637 6:104658111-104658133 AATGAAAGAAAAACTGTTAAGGG + Intergenic
1012988601 6:105901158-105901180 AATAAAATAGAAACAGTGGTGGG - Intergenic
1013090229 6:106893814-106893836 AATGGAATCCAAACTCTGTATGG + Intergenic
1013259049 6:108419983-108420005 AATGAAATGAAAACTGTGGCAGG - Intronic
1013485471 6:110592197-110592219 AATGAAATACACATTGTAGACGG + Intergenic
1013862463 6:114652264-114652286 TATGAAATATAAATTGAGGAAGG - Intergenic
1014694517 6:124602524-124602546 AAATAAATGCAAATTGTGGATGG + Intronic
1015106186 6:129539552-129539574 GCTGAGATACCAACTGTGGAGGG - Intergenic
1015673497 6:135718982-135719004 AATGAAATAAAAACTATAGTTGG + Intergenic
1015700776 6:136033963-136033985 AAAAAAATGCAAACTATGGAGGG - Intronic
1015850386 6:137565874-137565896 GGTGAAATACAATCAGTGGATGG - Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016075154 6:139787293-139787315 AATGAAAGAAAAACTGTTAAAGG - Intergenic
1017205524 6:151800812-151800834 AATGACAATCACACTGTGGAGGG - Intronic
1017395980 6:154000982-154001004 ACTTAAATACAAATTGTGGCCGG + Intergenic
1018219155 6:161561369-161561391 AGTGAAATATAAAGTATGGATGG - Intronic
1018296545 6:162352056-162352078 AATGAAAGACAGACTGAGCAGGG + Intronic
1019401621 7:857297-857319 ACTGAAATAAAAGCTTTGGAAGG - Intronic
1021152460 7:17168037-17168059 AAGGAAGGACAAACTTTGGAGGG - Intergenic
1021581643 7:22160504-22160526 AATGAAATACTTACTGACGACGG + Exonic
1021691469 7:23234605-23234627 ATTGGAACACAGACTGTGGATGG + Intergenic
1022100653 7:27167107-27167129 AATGAAAAACACACTGTTGCAGG - Intronic
1022386947 7:29909598-29909620 AATGAAATAGAAAATCTGGCTGG + Intronic
1023031386 7:36093064-36093086 AATTAAATACAAACATTTGAAGG + Intergenic
1025805614 7:64830332-64830354 ATTAAAAAACAAATTGTGGAGGG - Intronic
1026508546 7:71007690-71007712 AATGAAAGAGACACTGAGGAGGG - Intergenic
1027412882 7:77940991-77941013 TATGATATAAAAACTCTGGAGGG + Intronic
1027603351 7:80268083-80268105 AATGAACTACAATTTGTTGATGG + Intergenic
1028339241 7:89697273-89697295 AATAAAATATAAACTGCAGAAGG + Intergenic
1028975751 7:96911728-96911750 AATCAAATACCAACTGTATATGG - Intergenic
1030617947 7:111757874-111757896 TATGAAATACTAACTGGGGGGGG + Intronic
1030943241 7:115681872-115681894 AATGAAATACACACTCTCGGTGG + Intergenic
1030977143 7:116140753-116140775 AATGCACTACAGAGTGTGGAGGG - Intronic
1031254468 7:119429836-119429858 AATGAAAGACAAAATGTTAAGGG + Intergenic
1031483048 7:122300813-122300835 GATGAAAACCAAACTGTGGCGGG - Intergenic
1031651325 7:124293788-124293810 AATGAAAGACAACCTTTGGGGGG + Intergenic
1031938962 7:127766879-127766901 AATTACATACAAACAGTGGTGGG - Intronic
1032409247 7:131682364-131682386 CATGAGATACAAACTGTAGTAGG - Intergenic
1032845502 7:135748431-135748453 AATGCAATTCAAAATTTGGAGGG - Intronic
1034352804 7:150428310-150428332 GATGCAAGATAAACTGTGGATGG + Intergenic
1035101875 7:156404316-156404338 AATGAAATAAAAATGGTAGAAGG - Intergenic
1036834151 8:12045267-12045289 AATGGCATCCAAACTGTTGAGGG - Intergenic
1036855997 8:12291832-12291854 AATGGCATCCAAACTGTTGAGGG - Intergenic
1037119755 8:15268229-15268251 AATAAAACAAAAGCTGTGGAAGG - Intergenic
1038082235 8:24151755-24151777 AATGATATAATTACTGTGGAGGG - Intergenic
1038250458 8:25899229-25899251 AAAAAAAAAAAAACTGTGGAGGG - Intronic
1038865423 8:31434345-31434367 AAAAAAAAAAAAACTGTGGATGG - Intergenic
1039219777 8:35317179-35317201 ATTGAAATAGAAAATGTCGATGG - Intronic
1040082305 8:43299350-43299372 AATAAAATACAAACTGGAGGTGG - Intergenic
1040873286 8:52123313-52123335 AATGAAATACAAAGTGCATATGG - Intronic
1041067808 8:54099343-54099365 TATGTAATACAAACTTTGTATGG - Intronic
1041085255 8:54250667-54250689 AATTAAAAAAAAATTGTGGAGGG + Intergenic
1041602356 8:59734810-59734832 TATGAAAAACAAACTGATGAGGG + Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042044029 8:64627990-64628012 AATGAAATACACACTGCCCATGG + Intronic
1043360972 8:79471545-79471567 ATTGAAATAGAATCTGTAGATGG - Intergenic
1043396667 8:79844006-79844028 AATGAAAGAAAAACTGTTAAGGG + Intergenic
1043600744 8:81934866-81934888 AATTACATACAAGCAGTGGAAGG - Intergenic
1044312800 8:90713599-90713621 AGTGAAATAGGTACTGTGGAGGG - Intronic
1044691793 8:94887546-94887568 AATGAAATGCATACTGTGTTGGG - Intronic
1044810015 8:96050590-96050612 AAAGAAATACAAGCTGGGCATGG + Intergenic
1045171460 8:99674858-99674880 AATAACATTCAAAATGTGGAGGG - Intronic
1046115308 8:109777100-109777122 AATAAAATACAAAGAGTAGAGGG - Intergenic
1046362262 8:113176635-113176657 TCTGAAATTCAAACTCTGGATGG - Intronic
1046400334 8:113696982-113697004 AATGAAATACAGGCTGAGGTGGG + Intergenic
1046712653 8:117528766-117528788 AATGCAATGAAAACTGTGGTGGG + Exonic
1047172678 8:122509279-122509301 AATAAAATATAAAATGTGGAAGG - Intergenic
1047641585 8:126826911-126826933 AATGAACTAGGTACTGTGGAAGG + Intergenic
1047727059 8:127693298-127693320 AATGAAATAAAAACATGGGATGG - Intergenic
1048892149 8:138957652-138957674 AATAAAATTCAACCTGTGAAAGG + Intergenic
1050197597 9:3104054-3104076 AAAGAGAAACAAACTATGGAGGG + Intergenic
1050777530 9:9284803-9284825 AATGAAATAAAAGCTGGGAAAGG - Intronic
1050912231 9:11085810-11085832 AAAGAAATACAAATGGAGGAGGG + Intergenic
1052425676 9:28301795-28301817 AATGAAATACAGAATGTTAAAGG + Intronic
1052603948 9:30673550-30673572 CATGAAATTCAAACTTAGGAAGG + Intergenic
1053091453 9:35281553-35281575 AATGTAATACAAATTTGGGATGG + Intronic
1053368298 9:37539577-37539599 AATGTATTACAAAATGTGAAGGG + Intronic
1056042070 9:82678431-82678453 AATGAAAAATAAACACTGGAAGG + Intergenic
1056225844 9:84494235-84494257 AAGGAAAAACAAGCTGTGCATGG + Intergenic
1056323423 9:85458180-85458202 AATGAAATACTTAGTGTGGTGGG + Intergenic
1057784410 9:98075543-98075565 AATGAAATGCAAACTCTGATTGG - Intronic
1060647890 9:125297686-125297708 CATGAAATAAAGCCTGTGGATGG + Intronic
1185802142 X:3021076-3021098 AACGAAATACAAACACTGAAAGG + Intronic
1186189964 X:7058298-7058320 AGTGAAATACAACATTTGGAAGG + Intronic
1186266300 X:7837715-7837737 AATGAAATACAATCCATGGCAGG - Intergenic
1186309471 X:8302137-8302159 AAGGAAAAACATACTCTGGAAGG + Intergenic
1188851394 X:35136956-35136978 AATGAAAGAAAAAATGTTGAGGG - Intergenic
1188927106 X:36057344-36057366 AATGAAAATTAAACTGTGAATGG + Intronic
1188994333 X:36864200-36864222 AATGAACTACACATTGTGGAGGG - Intergenic
1191059537 X:56279951-56279973 AATGAATCACAATCTTTGGAGGG - Intronic
1192742140 X:73903852-73903874 AATGAAATACAAACTCTGGCTGG - Intergenic
1192920855 X:75704360-75704382 AATGAAATAAAAAATGTTAAGGG + Intergenic
1193048209 X:77075535-77075557 AATCAAATAAAAACTGTTAAGGG - Intergenic
1193094294 X:77529373-77529395 AATGAAAGAAAAAATGTTGAGGG + Intronic
1193251849 X:79299906-79299928 CATGAAATTAAAAATGTGGATGG + Intergenic
1193272926 X:79549832-79549854 AATGAACTAGAAACTGAGAAAGG + Intergenic
1193504124 X:82318984-82319006 TATGAAAGACAAAATGGGGAGGG - Intergenic
1193960283 X:87916119-87916141 AATGAAAGACAAAATGTCAAAGG + Intergenic
1194362865 X:92976280-92976302 AATGGCATATAAACTCTGGATGG - Intergenic
1194624204 X:96209651-96209673 TATGACATACAAACTGAGGCTGG + Intergenic
1194650315 X:96506406-96506428 AGAGAAAAACAAAATGTGGAGGG + Intergenic
1194708317 X:97201884-97201906 AATGAAAGAAAAACTGTTAAGGG + Intronic
1195329053 X:103781679-103781701 AATGAAAGAAAAACACTGGAGGG + Intronic
1197428246 X:126324639-126324661 AATGAAATAGAAAATGTTAAGGG + Intergenic
1197540474 X:127753692-127753714 AATGAAATGGAAAGTGGGGAAGG - Intergenic
1200039003 X:153352657-153352679 ACGGAAATACAAACTGGGGTGGG - Exonic
1200671109 Y:6092509-6092531 AATGGCATATAAACTCTGGATGG - Intergenic
1200680970 Y:6210638-6210660 AATGAAAAAAAAACTGAAGAAGG + Intergenic
1201582971 Y:15530689-15530711 AATGAAGGACAAAATGTTGAGGG - Intergenic
1201640739 Y:16174095-16174117 TGTGAAATAATAACTGTGGAAGG + Intergenic
1201662076 Y:16411231-16411253 TGTGAAATAATAACTGTGGAAGG - Intergenic
1201961372 Y:19683968-19683990 AATGAAATACAAACTTTGTTAGG + Intergenic
1202025187 Y:20514422-20514444 AAAGAAATAGAGAATGTGGAAGG + Intergenic