ID: 996797702

View in Genome Browser
Species Human (GRCh38)
Location 5:127367801-127367823
Sequence CCATCAGTACCTAAGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996797702 Original CRISPR CCATCAGTACCTAAGACAAG TGG Intronic
903117206 1:21188162-21188184 CCAGCAGTCTCTAAGCCAAGGGG + Intergenic
905168260 1:36096249-36096271 CCCTCAGTCCCTACGTCAAGCGG - Exonic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
909072416 1:71012475-71012497 ACATCATTATCTAAGAAAAGGGG + Exonic
911371087 1:96995775-96995797 AAATCAGTCCTTAAGACAAGAGG + Intergenic
912231117 1:107793920-107793942 CCAGCAGTACGCAAGTCAAGTGG - Intronic
1063168027 10:3481458-3481480 CCACTAGAACATAAGACAAGAGG + Intergenic
1065994210 10:31041300-31041322 CCACCAGCACCAAAGACCAGAGG + Intergenic
1068543977 10:58326455-58326477 CCAGCAGTACCTGAGAAATGAGG + Intergenic
1069537383 10:69264963-69264985 CAATCAGAACCTTAGAGAAGGGG - Intronic
1071871543 10:89800542-89800564 CAATTAGTAACTAAGAAAAGGGG + Intergenic
1075114699 10:119616426-119616448 ACCTCAGTAGCTAAGACAACAGG - Intergenic
1075346067 10:121682696-121682718 CCATCCATTCCTAAGGCAAGTGG + Intergenic
1076060107 10:127407391-127407413 TCATCAGTGCCTCAGAAAAGAGG - Intronic
1085793993 11:79520197-79520219 CCACCCCTACCTAAGACAGGAGG - Intergenic
1089566213 11:119373082-119373104 CCATCAATGCCTATGACCAGGGG - Exonic
1090685424 11:129112256-129112278 CCATCAGTTCCTCAGACTAATGG - Intronic
1093529333 12:20142105-20142127 CAAGTAGTACCTAAGAAAAGAGG - Intergenic
1095203965 12:39418082-39418104 CCATGAGTAGCTGAGACTAGAGG - Intronic
1096288612 12:50322288-50322310 CCATCAGGAGCTCAGCCAAGTGG + Intergenic
1106818488 13:33436833-33436855 CCATCAGTGACTGAGACCAGAGG + Intergenic
1110471245 13:75862568-75862590 CCATAAGTACAGAAGACAAAGGG - Intergenic
1116388506 14:44361984-44362006 CCATCAATATCTAAAACATGAGG - Intergenic
1118353089 14:64987914-64987936 CCATCTGTCCCTAGGAGAAGTGG + Intronic
1118596455 14:67438998-67439020 GCATCAGTTCCTAAAGCAAGTGG + Intergenic
1120271088 14:82313972-82313994 CCATAAGTACATAAAACATGTGG - Intergenic
1125397961 15:39270474-39270496 CTCTTAGTACCTAAAACAAGTGG + Intergenic
1126303733 15:47230497-47230519 TCTCCAGTACCTAACACAAGTGG + Intronic
1130017384 15:80198097-80198119 CCAACAGTCCCAGAGACAAGTGG - Intergenic
1130995088 15:88899148-88899170 CCCTCAGTGCCTAAGAAAACAGG + Exonic
1133294691 16:4745638-4745660 CCAAAAGTACCTAACAGAAGTGG + Intronic
1133519237 16:6541202-6541224 CCTTCAGAGCCTAAGACAGGAGG - Intronic
1135159058 16:20077379-20077401 CCATCAGGAGCTCAGACTAGTGG + Intergenic
1135504348 16:23023111-23023133 CCATCAGTACCACAGATAGGAGG - Intergenic
1138927188 16:61606681-61606703 CTCTAAGTACCTCAGACAAGTGG + Intergenic
1139014312 16:62671348-62671370 TCCCCAGTACCTAAGACAACAGG - Intergenic
1140101270 16:71919508-71919530 CCCTGAGTAGCTGAGACAAGAGG + Intronic
1141405003 16:83784877-83784899 ACATTAGTACCTGAGACAGGAGG - Intronic
1144392758 17:14811275-14811297 CTATGAATACCAAAGACAAGTGG + Intergenic
1150200532 17:63352238-63352260 ACATCAGCACTTATGACAAGGGG - Intronic
1156385620 18:36602285-36602307 CCATCAGCACAGAAGAAAAGGGG - Intronic
1158539567 18:58340495-58340517 CCATCAGTATCCTAGAGAAGGGG + Intronic
1162435674 19:10656532-10656554 ACAGCAGTCCCTAAGAGAAGAGG - Intronic
1164811105 19:31156676-31156698 TCATCAGTATCAAAGCCAAGTGG + Intergenic
1165729810 19:38137828-38137850 CCATCAGTACCTAAGGGAAAAGG + Intronic
929205544 2:39288111-39288133 CCACCATTACCTAAGGCAACAGG + Exonic
929764290 2:44831430-44831452 CCATCAGAACCTCAGAAAGGAGG - Intergenic
931978181 2:67666238-67666260 CCTTCAGTACCAGAGTCAAGGGG + Intergenic
937986688 2:127641234-127641256 CCATCAGTGCCTTAGAGGAGGGG - Intronic
940772016 2:157849181-157849203 CCATCAGTACCTGTGATCAGTGG - Intronic
1170788297 20:19486730-19486752 CTATAAGTATCTAAGAAAAGAGG + Intronic
1171311057 20:24144809-24144831 ACATCAGGACCTATGACAATTGG - Intergenic
1171940037 20:31319467-31319489 CCCTCAGTAGCTAAGACTATAGG + Intergenic
1173512653 20:43642466-43642488 TCTTCAGTACCTAAGACAGTTGG - Exonic
1175879244 20:62247264-62247286 TCTTCAGTGCCTAAGCCAAGAGG - Intronic
952068384 3:29601071-29601093 CAATCAGTACCTAATTAAAGAGG - Intronic
953876727 3:46670909-46670931 CCCTCATTACCCAAGGCAAGGGG - Exonic
958841924 3:99216141-99216163 CCTTCATTACCTTAGTCAAGAGG + Intergenic
959003510 3:100992609-100992631 CCATCAGAAACCAAAACAAGAGG - Intronic
961330965 3:126137735-126137757 CTATGACTACATAAGACAAGAGG - Intronic
963639677 3:147843189-147843211 TCCTCAGTGCCTAAGACAAGAGG - Intergenic
965995764 3:174880893-174880915 CCACCAGAATCTAAGAGAAGGGG - Intronic
968540650 4:1166638-1166660 CGATCAGAAGCTCAGACAAGGGG - Intergenic
971288871 4:25317114-25317136 TCATCAGTAACCTAGACAAGAGG - Intronic
972332654 4:38078314-38078336 CAATCTGTACCTAAGAAAAAAGG - Intronic
976575831 4:86670049-86670071 GCATCAGTCCCCAAGAGAAGAGG + Intronic
976726416 4:88220057-88220079 CCCTCACTACCTAATATAAGTGG + Intronic
978720861 4:111907398-111907420 CAATCAGTCCCTAAGAAAAGGGG + Intergenic
982306907 4:153942151-153942173 ACATCTGTACCTAAGTCATGAGG - Intergenic
983792905 4:171820812-171820834 CCACCAGTCCTTAAGACAGGTGG - Intronic
985611189 5:890432-890454 GCATTTGTACCTAAGACAAGGGG - Intronic
987026193 5:13929256-13929278 CCATAGGTACCTCACACAAGTGG - Intronic
989795580 5:45467267-45467289 ACATCAGAACCTAAGACATTGGG - Intronic
991468615 5:66943020-66943042 GCATCAGTACCTTATAAAAGAGG - Intronic
994437003 5:99749118-99749140 CAACCATTAACTAAGACAAGAGG - Intergenic
995904807 5:117110748-117110770 TCAGCAATACCTAAGACAACAGG - Intergenic
996797702 5:127367801-127367823 CCATCAGTACCTAAGACAAGTGG + Intronic
999176864 5:149638112-149638134 CCCTCAGGACCCAGGACAAGGGG - Intergenic
1001672784 5:173488056-173488078 CCATCAGAACCTAAAGCAGGTGG + Intergenic
1002790204 6:431911-431933 CCATGAGTATCTAGGAAAAGAGG - Intergenic
1004376168 6:15092573-15092595 CCATCATTACCAAGGAGAAGTGG - Intergenic
1005451067 6:25972875-25972897 CCATCAATACCTAAGACTGGTGG + Intronic
1013023325 6:106242381-106242403 CCATAGGTACCTCATACAAGAGG - Intronic
1013747562 6:113363935-113363957 CCAAGAGAACATAAGACAAGGGG - Intergenic
1013913126 6:115302258-115302280 CAAACTATACCTAAGACAAGAGG - Intergenic
1020663941 7:11015779-11015801 CCATGATTACCTAAAATAAGTGG - Intronic
1024352211 7:48377983-48378005 CCATCAGCATCTAAGGCTAGAGG + Intronic
1032584927 7:133137585-133137607 CCATCAGTGTTTAAAACAAGAGG + Intergenic
1035579334 8:730596-730618 GCATTAGTACCAAAGACAGGAGG - Intronic
1037658918 8:20910673-20910695 CCACCAGGAGCTAAGCCAAGTGG + Intergenic
1039449225 8:37658314-37658336 CCAGCAGAAGCTAAGAAAAGAGG - Intergenic
1041443366 8:57923498-57923520 GCATCAGAACCTAAAGCAAGAGG + Intergenic
1041761863 8:61375953-61375975 ACATCAGTAACTATGACAACAGG - Intronic
1047480617 8:125278554-125278576 TAATCAGTACCTAAAACAATAGG - Intronic
1048561221 8:135539457-135539479 CCTTCAGAACCTATGGCAAGTGG - Intronic
1049889706 9:57523-57545 CCATCAATACCAGAGAGAAGAGG + Intergenic
1053173456 9:35906681-35906703 CCATCTGTTCCCAGGACAAGTGG + Exonic
1053731188 9:41058798-41058820 CCATCAATACCAGAGAGAAGAGG + Intergenic
1054697321 9:68373291-68373313 CCATCAATACCAGAGAGAAGAGG - Intronic
1058326884 9:103709556-103709578 CCATTTGTAACTAAAACAAGAGG + Intergenic
1059829811 9:118082774-118082796 ACACCAGGACCTAAGACAAATGG - Intergenic
1061732431 9:132626279-132626301 CCATCAGTAATTAAGAGATGGGG - Intronic
1188145819 X:26612059-26612081 CCAGCTGCACCTAAGCCAAGAGG + Intergenic
1188251096 X:27895928-27895950 ACATGAGTACCTCATACAAGTGG + Intergenic
1190109731 X:47582304-47582326 CCATCAGTGCAGAAGCCAAGGGG - Exonic
1196157052 X:112441883-112441905 CCATCAGCAAGTAAAACAAGAGG + Intergenic
1196776621 X:119343844-119343866 CCAACAGCACCTAATACAAGGGG - Intergenic