ID: 996801924

View in Genome Browser
Species Human (GRCh38)
Location 5:127413753-127413775
Sequence AGGAAGCTAGAGCACTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996801924_996801927 12 Left 996801924 5:127413753-127413775 CCTCCAAAGTGCTCTAGCTTCCT 0: 1
1: 1
2: 1
3: 15
4: 156
Right 996801927 5:127413788-127413810 AAATTGCAGAATACTAATTTTGG 0: 1
1: 0
2: 5
3: 33
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996801924 Original CRISPR AGGAAGCTAGAGCACTTTGG AGG (reversed) Intronic
900421853 1:2559180-2559202 AGGAAGCTGGAGTGCTTTGGGGG + Intronic
901002354 1:6155061-6155083 AGGAAGCTGGGGCGTTTTGGGGG - Intronic
903636671 1:24823422-24823444 AGGAAGCGAGATAAATTTGGAGG + Intronic
904964004 1:34357630-34357652 AGGAGACTAGAGCACCTTGCGGG + Intergenic
905653320 1:39671066-39671088 ATCAAGCTGGAGCTCTTTGGAGG + Intronic
907938399 1:59063620-59063642 TGGAAGCCAGACCTCTTTGGAGG + Intergenic
908059299 1:60329809-60329831 AGGGAGCTTCAGCAATTTGGTGG + Intergenic
909713440 1:78678464-78678486 AAGAAGCTGAAGCTCTTTGGAGG + Intergenic
910549461 1:88459680-88459702 AGGAGGTTAGAGGAATTTGGAGG - Intergenic
913470721 1:119182765-119182787 AGCAAGCGAAAGCGCTTTGGAGG + Intergenic
913515328 1:119600545-119600567 AGGAACCCAGAGCTCTCTGGGGG + Intergenic
915382653 1:155456534-155456556 AAGAAACTCGAGCATTTTGGAGG - Intronic
917321077 1:173781833-173781855 AGGAAGTGAGAGCAGTTTGGAGG + Intronic
918931932 1:190865170-190865192 TGTAAGCTAAAGCACTTTTGTGG - Intergenic
919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG + Intergenic
920391748 1:205608314-205608336 AGGATGCAAAAGCACTTTGAGGG - Exonic
921810315 1:219504929-219504951 AAGCAGCAAGAGCACTTTAGGGG + Intergenic
923411738 1:233716998-233717020 AGAAAGCTTGTGCACTTTTGGGG + Intergenic
1067149069 10:43714804-43714826 AAGATGGAAGAGCACTTTGGGGG - Intergenic
1067574289 10:47398614-47398636 AGGAAGCCAGTGCTCTTGGGTGG - Intergenic
1067735294 10:48845852-48845874 AGGAAGCTGGAGCACAGTGCTGG - Intronic
1068341681 10:55712330-55712352 AGAAAGCTAGAGAACTTAGTAGG - Intergenic
1069173714 10:65263529-65263551 AAGAGGCTAGAACAGTTTGGAGG - Intergenic
1070091247 10:73287786-73287808 AGGAAGATAGAAGGCTTTGGAGG + Intronic
1071882790 10:89917768-89917790 AGGAAGCCAGGGCACTTTCCTGG + Intergenic
1073211631 10:101808342-101808364 AGGAGGCTAGGCCACTTTGTTGG - Intronic
1075012720 10:118888507-118888529 AGGAAGGTAGAGCAAGTTTGAGG + Intergenic
1077891990 11:6425496-6425518 GGGAGGCCAGATCACTTTGGTGG - Intergenic
1084978544 11:72816299-72816321 AGAAAGCTAGAGCCCTTGGAGGG + Intronic
1085577456 11:77619774-77619796 AGGAAGCTAGTGCCCTCTGCTGG + Intronic
1088402034 11:109431855-109431877 AGGAAGCCAGAGTACTTTGAGGG - Intergenic
1088689108 11:112310107-112310129 AGGAAGCTAGACCAATTGAGAGG + Intergenic
1088769929 11:113024038-113024060 AGGTACCTTGATCACTTTGGAGG + Intronic
1089337336 11:117734285-117734307 AGGAAGCAAGAGCACTTACGGGG + Intronic
1091995401 12:4988991-4989013 AGGAGGCTGGACTACTTTGGTGG - Intergenic
1092114139 12:5986608-5986630 AGGAGGGCAGGGCACTTTGGGGG - Intronic
1095446097 12:42283927-42283949 AGGAAGCTATTGCACAATGGGGG + Intronic
1099407349 12:82280922-82280944 AAGAAGCTGGAACAGTTTGGAGG + Intronic
1100631284 12:96391829-96391851 AGCAATCTAGAGCAGTTTGTAGG - Intronic
1104157873 12:126150955-126150977 AGGAGGCAGGAGCAATTTGGAGG + Intergenic
1108582167 13:51837032-51837054 AGGCAGCAAGAACACTTAGGAGG + Intergenic
1108796482 13:54037918-54037940 AGGAAGCTAGAAAACGATGGGGG + Intergenic
1114860235 14:26509476-26509498 ATGAAGCTTGAGAACTTTGGAGG - Intronic
1116114823 14:40634812-40634834 AGGAAGCTACAGAACTATTGAGG + Intergenic
1116631399 14:47339588-47339610 AGGAAGCATGAGCAAGTTGGAGG - Intronic
1124483704 15:30098428-30098450 CTGAAGGTAGCGCACTTTGGAGG + Intergenic
1124519875 15:30398798-30398820 CTGAAGGTAGCGCACTTTGGAGG - Intergenic
1124538779 15:30567425-30567447 CTGAAGGTAGCGCACTTTGGAGG + Intergenic
1124759872 15:32440156-32440178 CTGAAGGTAGCGCACTTTGGAGG - Intergenic
1125919670 15:43518000-43518022 AGGATGCTGGAGGAGTTTGGGGG + Intronic
1128513947 15:68330579-68330601 AAGAAGTCAGAGCGCTTTGGAGG + Intronic
1129380837 15:75165113-75165135 AGGAAGTTAGAGAACTTAGGGGG + Intergenic
1130852162 15:87805376-87805398 AGGGAGCAAGAGAACCTTGGTGG + Intergenic
1131829557 15:96345324-96345346 GAGAAGCTAGATCAGTTTGGGGG - Intergenic
1132996788 16:2827657-2827679 AGGAAGAGAGAGCACACTGGAGG - Intergenic
1133596571 16:7299434-7299456 AGAAAGCTAGAGGAGTTTGAGGG + Intronic
1133888251 16:9852496-9852518 AGGAAGTTATTGCACTCTGGGGG - Intronic
1134770462 16:16804774-16804796 AGGGAGCTAGAGAAGGTTGGAGG + Intergenic
1139427468 16:66891691-66891713 AGGAAGCTAGAAGGCTTTTGGGG + Intronic
1140921237 16:79540607-79540629 GGGAAGCCAGACCACTTTGCTGG + Intergenic
1144629664 17:16864560-16864582 AGGCAGGTAAAGCACTTAGGAGG + Intergenic
1144651764 17:17011557-17011579 AGGCAGGTAAAGCACTTAGGAGG - Intergenic
1145270402 17:21401706-21401728 AGGACTCTAGAGCACTCTTGGGG + Intronic
1145308613 17:21689103-21689125 AGGACTCTAGAGCACTCTTGGGG + Intergenic
1147868929 17:43573734-43573756 ACAAAGCTGGAGCACTTAGGTGG - Intronic
1148906726 17:50917121-50917143 AGGAAGGTAGAGTCGTTTGGGGG - Intergenic
1149555225 17:57568837-57568859 AGGGGGCTGGAGCACTGTGGTGG + Intronic
1152303145 17:79507018-79507040 AGGCAGCTGGAGCCCGTTGGTGG + Intronic
1156194713 18:34761050-34761072 AGGAAGATAAAGGAGTTTGGGGG - Intronic
1156801863 18:41125031-41125053 AGGAAGCTGGAGGAATTGGGGGG - Intergenic
1158105743 18:53883051-53883073 AGGAAGAAAGAGCAGTGTGGTGG - Intergenic
1159654436 18:71014909-71014931 AGGTAGCAAGAGAACTTTGGAGG - Intergenic
1161790954 19:6359849-6359871 AGGTAGGTAGAGGGCTTTGGAGG - Intergenic
1165931604 19:39362738-39362760 AGGAAGCTACAGGACAGTGGAGG - Intronic
925635594 2:5938532-5938554 TGGAAACAAGAGCACTCTGGTGG + Intergenic
926931419 2:18044914-18044936 ATGGAGCGAGTGCACTTTGGAGG - Intronic
927518236 2:23684484-23684506 AGGAAGCTAGAACATTTTGGTGG - Exonic
930420399 2:51145506-51145528 AAGGAGCTAGTGCCCTTTGGGGG + Intergenic
930521228 2:52470129-52470151 AGGAGGCTGGAACAGTTTGGAGG + Intergenic
931466547 2:62492851-62492873 AGGCAGACAGAGCAGTTTGGAGG + Intergenic
932684596 2:73857426-73857448 AGGCAGCTTGAGCACTCAGGGGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933312322 2:80676199-80676221 ATGAAGCTGGAGCCCTTTGGAGG - Intergenic
934541996 2:95183265-95183287 AGAAAGCTAGAGGAATTTGTAGG + Intronic
934870410 2:97860148-97860170 AGGAAGCTATAGAAGTTAGGAGG - Intronic
936730411 2:115375499-115375521 CAGAAGCTGGAGCAATTTGGAGG - Intronic
939713627 2:145555723-145555745 GGGGAATTAGAGCACTTTGGTGG + Intergenic
942498985 2:176568471-176568493 AGGAAGTTAGAGGACAATGGAGG - Intergenic
943877206 2:193084378-193084400 AGGAACCTGGAGCACTATAGAGG + Intergenic
944721584 2:202428112-202428134 AGGGAGCTACAGCTCTTTGTTGG - Intronic
945175514 2:207039493-207039515 AGGAAGCTAGAGTACATAGGAGG - Intergenic
945210240 2:207375253-207375275 AGGAAGATAGAGCACTAAGCAGG + Intergenic
946097025 2:217283492-217283514 AGCAGCCTAGAGCACTCTGGGGG - Intergenic
946155150 2:217802232-217802254 CAGAAGGAAGAGCACTTTGGAGG + Exonic
946306116 2:218857954-218857976 AGGCAGCTAGAGGGCTCTGGGGG - Intergenic
1168992168 20:2103849-2103871 AGGAAGCCACAGGAGTTTGGGGG - Intronic
1169977680 20:11348558-11348580 AAAAATCTAGAGCAATTTGGTGG + Intergenic
1170559129 20:17540716-17540738 AGGAAGCTAGAGGACATGAGAGG - Intronic
1172645581 20:36467276-36467298 AGGAAACAAGAGCCCTTTGAGGG + Intronic
1172975788 20:38904791-38904813 AGGAAGCCAGAGAACCTCGGGGG - Intronic
1173356852 20:42301248-42301270 AGGAAGCAACATCACTTTTGTGG + Intronic
1174012900 20:47465034-47465056 AGGAAGTCATAGGACTTTGGGGG - Intergenic
1177106235 21:16958818-16958840 AGCTAGCTAGAGCATTTTGAAGG - Intergenic
1177235186 21:18380106-18380128 ATGAAGCTATGGCACTTGGGAGG - Intronic
1178615888 21:34132470-34132492 AGGAAGTCAGAGCAGTTAGGAGG + Intronic
1181312178 22:21951265-21951287 AGGAAGCTACACCACTCTGAAGG + Intronic
1183271672 22:36866148-36866170 AAGAAGAAAGAGAACTTTGGGGG - Intronic
951159765 3:19404270-19404292 AGAAAGCAACAGCTCTTTGGAGG - Intronic
954350276 3:50037578-50037600 AGGAAGCTCAAGTACTTGGGTGG + Intronic
956938691 3:74132650-74132672 AGGCAGTTAGAACAGTTTGGAGG - Intergenic
958904458 3:99926893-99926915 AGGAAGGGAGACCACTTAGGGGG - Intronic
959359629 3:105371731-105371753 AGGGAGCTAGAACTCTTTGATGG - Intronic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
961146823 3:124600989-124601011 AGTAAGCTAGAGCTTTTTGTGGG + Intronic
961432002 3:126890084-126890106 AGTGAGCTGGAGCACCTTGGGGG - Intronic
962492940 3:135911270-135911292 AGGAAGCCAAAGCACTGCGGAGG - Intergenic
962902187 3:139771248-139771270 AGGAAGCCAGAGAAGTTTGGAGG + Intergenic
966903919 3:184508179-184508201 AGGAAGCTTGGGGCCTTTGGTGG + Intronic
968647446 4:1747768-1747790 AGGCCGGGAGAGCACTTTGGAGG + Intergenic
971059655 4:22953401-22953423 AGGAACTTAGAGCAATATGGAGG - Intergenic
971840874 4:31850500-31850522 AAGAAGCTGGAACAGTTTGGAGG + Intergenic
972405458 4:38742226-38742248 AGGAAGCTAGAACCAATTGGGGG + Intergenic
974118939 4:57614529-57614551 AGGAAGGCAGAGCAATTGGGTGG - Intergenic
975894390 4:79069995-79070017 AGGAAGATAGAGTATATTGGTGG + Intergenic
977571396 4:98633012-98633034 AGGAAGCCAGGGCAGTTGGGAGG + Intronic
984087544 4:175331241-175331263 AGAAAGGTAGAGCACTTCAGAGG + Intergenic
986728133 5:10614991-10615013 AGGAAGCTGGAGGAGTGTGGTGG + Intronic
987047309 5:14120190-14120212 AGGAAAGAAGAGCACTTAGGAGG - Intergenic
987541351 5:19260410-19260432 CAGAAGCTAGAACAGTTTGGAGG + Intergenic
989034398 5:37154887-37154909 AGGAAGAGGGAGCAATTTGGAGG - Intronic
989255617 5:39363134-39363156 AGGGAGCTAAAGCAACTTGGAGG + Intronic
990118307 5:52416540-52416562 ATGCAGATAGAGCACTTTTGTGG - Intergenic
990866012 5:60380690-60380712 GGGAAGCTAGTGCACCTTGAAGG + Intronic
991707834 5:69376259-69376281 CTGAAGCTACAGCACTTAGGTGG - Intronic
993438471 5:87925955-87925977 AGGAATATGGAGAACTTTGGGGG - Intergenic
994764431 5:103899359-103899381 CAGAAGTTGGAGCACTTTGGAGG + Intergenic
995224014 5:109683644-109683666 AGGAGGCTAGAGCTTTTTGTAGG - Intergenic
995671551 5:114609773-114609795 GGGAAGAAAGAGCACTCTGGAGG + Intergenic
996801924 5:127413753-127413775 AGGAAGCTAGAGCACTTTGGAGG - Intronic
999698479 5:154206905-154206927 AGGCAGGGAGAGCAGTTTGGAGG + Intronic
1002860540 6:1075774-1075796 AGCAAGGAAGAGCACTTTGCAGG + Intergenic
1004265569 6:14145754-14145776 AGGAAGCAAGAGCAGCCTGGAGG + Intergenic
1006486960 6:34351047-34351069 AGGAAAAAAGAACACTTTGGTGG + Intronic
1006565009 6:34948605-34948627 AGGAAGCTAGAGCACTTTGAGGG - Intronic
1008880666 6:56377601-56377623 AGCAGGCTAAAGCACTCTGGGGG + Intronic
1010133121 6:72519226-72519248 AGGATGCTATAACATTTTGGAGG + Intergenic
1011731161 6:90265329-90265351 AGGATACTAAACCACTTTGGAGG + Intronic
1012271271 6:97215150-97215172 AGGAATCTTGAGCTCTTTGGTGG - Intronic
1013403689 6:109823543-109823565 ATGAAGATAGAGCCCTTTTGGGG + Intronic
1013833920 6:114309480-114309502 AGGCAGGCAGAGCACTTTTGAGG + Intronic
1014397025 6:120936870-120936892 AGGAAGCCAGAGAACATTAGTGG - Intergenic
1015007506 6:128300931-128300953 AAGAAGATAGAGCAGTGTGGTGG - Intronic
1016108079 6:140187777-140187799 CAGAAGCTGGAGCAGTTTGGAGG + Intergenic
1027993642 7:85396039-85396061 CAGAAGTTAGAGCAGTTTGGAGG - Intergenic
1030879120 7:114854323-114854345 AGGAAGCAAGAACAGTTTGCAGG - Intergenic
1032233737 7:130101461-130101483 AGGAAGATGGAGCAGTTTTGGGG + Intronic
1038216627 8:25567566-25567588 AGCCAACTAGAGCACTCTGGCGG - Intergenic
1041361105 8:57055280-57055302 GGGAGGATAGAGCACTGTGGTGG + Intergenic
1043536978 8:81216008-81216030 AGGAGCTTAGAGCACTTTAGAGG - Intergenic
1045349398 8:101324321-101324343 AGGAAACTAGAGTCCTCTGGAGG - Intergenic
1049390309 8:142364518-142364540 AGGAAGCAAGAGCTCTGTGCTGG - Intronic
1051023487 9:12575392-12575414 AGGAACAGAGAGCAGTTTGGGGG - Intergenic
1052403852 9:28034082-28034104 ATGAAGCTAATTCACTTTGGAGG - Intronic
1053412312 9:37923678-37923700 AGGAAGCATGAGCACTTCTGTGG + Intronic
1053838762 9:42170141-42170163 AGGAGGCTAGAGCACTTATCTGG + Intergenic
1055587820 9:77774061-77774083 AGGAATGTGGACCACTTTGGTGG - Intronic
1055666379 9:78557054-78557076 AGGAAGTCAGTGCCCTTTGGAGG - Intergenic
1056847605 9:90054407-90054429 AGGAAGAAAGTGCACTTTGGAGG + Intergenic
1057796018 9:98158764-98158786 AGGCAGATAGAACAGTTTGGGGG + Intronic
1058950924 9:109903168-109903190 AGGGAGGAAGAGCACTTTGCAGG + Intronic
1061443546 9:130624074-130624096 AGGCAGCTTTAGGACTTTGGAGG - Intronic
1190808782 X:53864096-53864118 AGGAAGATGGAGAGCTTTGGGGG - Intergenic
1192188855 X:68978502-68978524 TGGAAACTATAGCCCTTTGGGGG - Intergenic
1195413724 X:104597435-104597457 AGGAAGGCAGACCACTTTTGAGG + Intronic