ID: 996807890

View in Genome Browser
Species Human (GRCh38)
Location 5:127478246-127478268
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996807890_996807891 -10 Left 996807890 5:127478246-127478268 CCAGTCTCATGATAACTTGGCAC No data
Right 996807891 5:127478259-127478281 AACTTGGCACTTTCCATTGCAGG No data
996807890_996807892 -9 Left 996807890 5:127478246-127478268 CCAGTCTCATGATAACTTGGCAC No data
Right 996807892 5:127478260-127478282 ACTTGGCACTTTCCATTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996807890 Original CRISPR GTGCCAAGTTATCATGAGAC TGG (reversed) Intergenic
No off target data available for this crispr