ID: 996813616

View in Genome Browser
Species Human (GRCh38)
Location 5:127548100-127548122
Sequence CCTGGAAAACAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 742}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996813616_996813620 -10 Left 996813616 5:127548100-127548122 CCTTCCTCCTTTTGTTTTCCAGG 0: 1
1: 0
2: 3
3: 55
4: 742
Right 996813620 5:127548113-127548135 GTTTTCCAGGTGTCTTTGAAAGG 0: 1
1: 0
2: 1
3: 25
4: 237
996813616_996813622 5 Left 996813616 5:127548100-127548122 CCTTCCTCCTTTTGTTTTCCAGG 0: 1
1: 0
2: 3
3: 55
4: 742
Right 996813622 5:127548128-127548150 TTGAAAGGTAATACATTACATGG 0: 1
1: 0
2: 2
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996813616 Original CRISPR CCTGGAAAACAAAAGGAGGA AGG (reversed) Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900749302 1:4384361-4384383 CCTGGGAAACTAATGCAGGAAGG + Intergenic
901187430 1:7384082-7384104 CCTGGGAAAGAAAAGGTGGCAGG + Intronic
902301522 1:15505838-15505860 CCAAGAAAACAACAGGAGGTGGG + Intronic
903105958 1:21080205-21080227 CTTGGAAAGCTAAGGGAGGAGGG + Intronic
903226652 1:21897515-21897537 CCTGAGAAACAAAGAGAGGAAGG - Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903679003 1:25084512-25084534 CATAGAAAACAAAAAGAAGAGGG + Intergenic
904118100 1:28176977-28176999 CCAGGAAAATCAAAGGAGAAAGG + Exonic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
905039220 1:34940173-34940195 GCTGGAATAAAAAAGAAGGAGGG - Intergenic
905105960 1:35563745-35563767 CCTGGAAAAGAAAGGGGGGAAGG - Exonic
905264303 1:36740384-36740406 CCTGGAGAGCAAGAGGTGGATGG + Intergenic
906333674 1:44909393-44909415 GCTGGAAAACAAAAGGATGGTGG + Intronic
906635748 1:47409374-47409396 CCTGGAAATGAGAAGCAGGAAGG + Intergenic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
907261140 1:53219682-53219704 CCTGGGAAACAAAAGTAGTCCGG + Intronic
907656802 1:56351661-56351683 ACTGGAAAATAAAAGGTGGGGGG - Intergenic
907702728 1:56804991-56805013 CCAGGCAAAGAAAAGCAGGAAGG - Intronic
908106498 1:60848557-60848579 CCTGGGAAAAAACAGGAGGGTGG + Intergenic
908532719 1:65049113-65049135 CCTGGACTTCAAAAGGAGTAAGG + Intergenic
908808204 1:67952363-67952385 GCTGGAAGACAAAAGGATAAAGG - Intergenic
909000317 1:70210155-70210177 CTTGGAAAAAAAAAGGGGGGCGG - Intronic
909439317 1:75679930-75679952 AATGGAAAACAAAAGAAGGCAGG + Intergenic
909474170 1:76063372-76063394 CCTGGATCCCAAAGGGAGGAGGG + Intergenic
909595345 1:77399973-77399995 CCAGGAAATCAGAAGGAGCAAGG - Intronic
910088694 1:83436151-83436173 CCAGGAAAAGGAAAGGAGGAAGG - Intergenic
910111486 1:83688334-83688356 AATGGAAAACAAAAAGAGGCAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910499615 1:87875025-87875047 ACTTGAAAAAAAAAGGAGGAAGG - Intergenic
910610493 1:89135981-89136003 AATGGAAAACAAAAAGAGCAGGG + Intronic
910904596 1:92161993-92162015 ACTAGAAAACAAAAGAAAGAAGG - Intergenic
911011328 1:93284180-93284202 CCTACAAAACAAAAGGTAGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911152268 1:94607216-94607238 CATGGAACACAAAAGGATGGGGG - Intergenic
911407619 1:97462545-97462567 CCTGAATTTCAAAAGGAGGAGGG - Intronic
911953228 1:104203851-104203873 CCTGGAAAAAAAAAGCAAGGGGG - Intergenic
912065075 1:105728387-105728409 CCTGGAAAAGAACATTAGGAAGG + Intergenic
912108814 1:106314702-106314724 AATGGAAAACAAAAAGAGGCAGG + Intergenic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
912568457 1:110605722-110605744 CCTGGAAAAAAACAGCAGCAAGG + Exonic
912575392 1:110666445-110666467 ACTGGAGCACAAAAGAAGGAAGG + Intergenic
913080016 1:115375110-115375132 CCTTGATAACAAAAGAAGTATGG - Intergenic
913516516 1:119610020-119610042 CCTGGAAATGAAAAGGAACAAGG - Intergenic
914142897 1:144966808-144966830 AATGGAAAACAAAAAAAGGAAGG + Intronic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914406930 1:147384698-147384720 CCTTGAAATTAAAAGGAAGAAGG - Intergenic
914456798 1:147843947-147843969 TCTGGAACAAAGAAGGAGGAAGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914676586 1:149911051-149911073 CCTGGAAGACAAAAGGGGCTCGG - Intronic
914777118 1:150747573-150747595 CCAGGAAAACAAAGTGATGAAGG + Intronic
914935388 1:151974629-151974651 TCTCAAAAAAAAAAGGAGGAAGG + Intergenic
915690389 1:157683244-157683266 CCTGCAAAACAAACAAAGGAAGG + Exonic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916493178 1:165320170-165320192 CCTAGAAAACCAAAGGACAAAGG - Intronic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
917045463 1:170854854-170854876 CCAGAAAAAAAAAAGGGGGAGGG + Intergenic
917098435 1:171422921-171422943 CTTGGGAATCTAAAGGAGGAAGG + Intergenic
918136860 1:181681458-181681480 ACTGGAAATAAACAGGAGGATGG - Intronic
919026447 1:192177535-192177557 CCTGGAAAACAAAAGTTAGCAGG + Intronic
919408861 1:197218779-197218801 ACTGGAGAACAAAGAGAGGAGGG + Intergenic
919700650 1:200628075-200628097 CCTTTAAAACAAAGGGAGCATGG - Intronic
920319162 1:205104438-205104460 GCTTGAAAACAGGAGGAGGAGGG + Intronic
920604984 1:207372484-207372506 CCTGTAAAACAAAAATAGGCAGG - Intergenic
921514671 1:216075373-216075395 CGAGGACAACAAAAGGAGAAAGG + Intronic
922011156 1:221589200-221589222 GCTGTAAAACATAATGAGGAAGG + Intergenic
922355647 1:224772688-224772710 CCTTGGAAAGAAAGGGAGGAGGG - Intergenic
922404209 1:225295497-225295519 CCTGAACAACAAATGGATGAAGG - Intronic
922747592 1:228053774-228053796 CCTGGAAAGAGAGAGGAGGATGG + Intronic
922848374 1:228708976-228708998 AATGGAAAACAAAAAAAGGAAGG + Intergenic
923010557 1:230084431-230084453 TCTGGGCAACCAAAGGAGGAGGG + Intronic
923769802 1:236928539-236928561 GCTGGAAGATAAAAGGAGCAAGG - Intergenic
923845175 1:237722203-237722225 ACTGGAAAACAAAATGGGTAAGG - Intronic
924883835 1:248190488-248190510 CCTGAAAGACATAAGGAGAATGG + Intergenic
1063341718 10:5271504-5271526 CCTGTAAAAGTAAAGAAGGATGG + Intergenic
1064452488 10:15455199-15455221 CCTGAATACCAAAGGGAGGAGGG - Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064920016 10:20505777-20505799 CATAGAAATTAAAAGGAGGATGG + Intergenic
1065070675 10:22021056-22021078 CCTTGGAAGCAAAAGGAAGAAGG + Intergenic
1065799829 10:29342038-29342060 CCTGGAGAAGAAAGGGAGAAGGG + Intergenic
1067426802 10:46216926-46216948 TCTGGAACTCAAGAGGAGGATGG + Intergenic
1067756639 10:49010632-49010654 CCAGGAAACTAAAAGGAGGAAGG - Intergenic
1068423572 10:56825986-56826008 CATGGAAAACAAAAGCAAGCAGG + Intergenic
1068505372 10:57893555-57893577 CCTGGATTCCAAAGGGAGGAAGG + Intergenic
1069572365 10:69502067-69502089 CCTGGCAACCAAAAGGAAAAGGG + Intronic
1070097904 10:73356202-73356224 CCTGAAAAAAAAAAAAAGGAAGG - Intronic
1070656817 10:78277347-78277369 CCAGGACAACAAAGGGAGAAAGG + Intergenic
1071085709 10:81866737-81866759 CCTGGAACACAGAAGTGGGAAGG - Intergenic
1071247852 10:83784883-83784905 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1072606226 10:96984940-96984962 CCTGCAAAACAGAAGGGGGCCGG + Exonic
1072790525 10:98314457-98314479 ACTGGAAAACAACACGGGGAGGG + Intergenic
1073218203 10:101848474-101848496 CCTGAGAAACAAAAAGGGGAAGG + Intronic
1073646251 10:105307339-105307361 CCTTTAAAACAATAGGAAGAGGG - Intergenic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1073892407 10:108116123-108116145 ACTGGAAAACAAAAAAAGGCAGG + Intergenic
1074999789 10:118787247-118787269 ACTGTAAAATACAAGGAGGAAGG - Intergenic
1075710332 10:124527294-124527316 CCTGGAAAAGTGAAGAAGGAAGG + Intronic
1076015786 10:127026652-127026674 ACTGGAAAGCAAAAGAAAGAAGG - Intronic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1077196050 11:1280725-1280747 GGTGGAAAGCAACAGGAGGAGGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078183064 11:9028689-9028711 CTTGGAAGAAAAGAGGAGGAAGG + Intronic
1078455662 11:11472781-11472803 CCTTGTATACAAAATGAGGATGG - Intronic
1078646886 11:13148802-13148824 CCTGGAAAAGAAAGGGAGGCTGG + Intergenic
1078853615 11:15188009-15188031 TCTGAGAAAGAAAAGGAGGAAGG + Intronic
1079645149 11:22853648-22853670 ATTGGAAAAAAAAAGAAGGAAGG + Intronic
1079772795 11:24484469-24484491 CCTGGAAAACAAGAGCAAAATGG - Intergenic
1080498791 11:32848657-32848679 CTTGGAAAACAAAAAAAGAAAGG + Intronic
1080523134 11:33085894-33085916 CCTGGAAACAGATAGGAGGAGGG + Exonic
1080726191 11:34901462-34901484 TCTGGAAATCAAAGGAAGGAAGG + Intronic
1080822237 11:35818632-35818654 CCTGGAAAAGAGAACCAGGAGGG - Intergenic
1080926838 11:36766382-36766404 CCTAAGAAAGAAAAGGAGGATGG - Intergenic
1082145023 11:48656564-48656586 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082311855 11:50659828-50659850 CCAGGTTAAAAAAAGGAGGAAGG - Intergenic
1082684563 11:56221765-56221787 AATGGAAAACAAAAAGAGGTAGG + Intergenic
1082713977 11:56590491-56590513 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1082744430 11:56946686-56946708 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1082898902 11:58224502-58224524 CCTGGAACTCAAAAAGAAGAGGG - Intergenic
1083125172 11:60558112-60558134 GCTGGAAAAAGAAGGGAGGAGGG + Intergenic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1083516068 11:63260437-63260459 CCTGAAAGAGAAAAGGAGAATGG - Intronic
1084532121 11:69733465-69733487 CCTAGGAAAGAAAAGGAAGAAGG + Intergenic
1084691104 11:70727300-70727322 CCTGGAAGACAAAATGTGGGAGG + Intronic
1084868009 11:72075598-72075620 ACTGAAAAACAAAGGGAGGAAGG - Intronic
1085726689 11:78960921-78960943 CCTGGAACACAGAAGGAGTGTGG - Intronic
1086338577 11:85824677-85824699 CCAGGAAAACTAAATGAGTAAGG + Intergenic
1086371126 11:86156680-86156702 TCTGGGTAACAAAAGGAGGAGGG + Intergenic
1087301106 11:96436945-96436967 TCTGGAACAGAAAATGAGGATGG + Intronic
1087500657 11:98949248-98949270 CCTGGAAAACAGGAGGGTGAAGG - Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1087787592 11:102372991-102373013 AATGGAAAACAAAAAGAGGCAGG - Intronic
1088117626 11:106330581-106330603 TCTTGAAAACAAAATGAAGATGG + Intergenic
1088436452 11:109818374-109818396 CTTGAAAAAAAAAAGGAGGTGGG + Intergenic
1088526269 11:110759260-110759282 CCAGGAAAACAGAAAGAGAAAGG - Intergenic
1088707140 11:112474212-112474234 TCTGGAGCACAAAAGAAGGAAGG - Intergenic
1088809517 11:113381747-113381769 CCTAAAAGAGAAAAGGAGGAAGG + Intronic
1089154195 11:116388022-116388044 TCTGCAAAACAAAAAAAGGAAGG + Intergenic
1089197152 11:116700841-116700863 CCAGGAAAACCAAAGGAGAGAGG - Intergenic
1089343175 11:117773296-117773318 GCTGGAACACAGAAGGAGCAGGG - Intronic
1089793523 11:120961833-120961855 CCTGGAAAACAGAAAGCTGAAGG - Intronic
1090208999 11:124902960-124902982 CCTGAAAAAAGAAAGGAGGGAGG - Intergenic
1091193937 11:133716254-133716276 CCTGGAAAACAAAAGCAAATGGG + Intergenic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091703245 12:2677711-2677733 CCTGGAATCCAAGGGGAGGATGG - Exonic
1091776875 12:3190420-3190442 CCTGGAAAACAGGAGAAAGAAGG - Intronic
1092352876 12:7770144-7770166 ACAGGAAAACAAAAGGAAAAGGG + Exonic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1092949549 12:13488539-13488561 CCAGGGAAACAAAAGGAAAAGGG + Intergenic
1093434651 12:19122625-19122647 CATGGAGAATAAAAGGAAGAAGG - Intergenic
1093772890 12:23038004-23038026 ACTGGAAAACACAATGAAGATGG - Intergenic
1094387641 12:29912204-29912226 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1094803974 12:34070645-34070667 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1094805408 12:34085539-34085561 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1095157398 12:38874356-38874378 CCTAGAAAGCAACAGGAGAATGG - Intronic
1095820647 12:46474981-46475003 GCTGGAAAATAAAAGAAAGAAGG - Intergenic
1096359865 12:50974807-50974829 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1096736520 12:53659701-53659723 CCCCGAAAACAAAAGCAAGAGGG + Intronic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1097752912 12:63377963-63377985 CCTGGAAAGCACAAGGAGTCAGG + Intergenic
1098236131 12:68420122-68420144 TCTGGAAAAGAAAAGAAGAATGG + Intergenic
1098394238 12:70001699-70001721 CCTGAAAAACAAAATGGTGAAGG - Intergenic
1098530628 12:71537747-71537769 CCTGGAAAATGAATGGAGAATGG - Intronic
1099342518 12:81455561-81455583 CTTGGATAATAAAGGGAGGAAGG - Intronic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1099909759 12:88815170-88815192 CCTGGAAAAAATAAAGAGGTAGG - Intergenic
1100088908 12:90946470-90946492 CCTTGAAAAAAAAAAAAGGAAGG - Intronic
1100245477 12:92752654-92752676 CCTGGAGAATGAAAGGAGAATGG + Intronic
1100653174 12:96612707-96612729 CATGGAAAACATAAAAAGGAAGG + Intronic
1100701597 12:97154503-97154525 ACTGAAAAACAAAAGGGGGCAGG - Intergenic
1100780681 12:98022972-98022994 CCTGGAAGACACAGGAAGGAGGG - Intergenic
1100919480 12:99465610-99465632 AATGGAAAACAAAAAAAGGAAGG + Intronic
1100982191 12:100170629-100170651 CCTGGAATACTAAAGGCGGCTGG + Intergenic
1101279593 12:103238794-103238816 CCTGAAAGACTAAAGGAAGAGGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102300469 12:111767334-111767356 CCTGGAAAACAGACCGAGGCTGG - Intronic
1102386868 12:112517309-112517331 CCTGGAGATCAAAGGGAGGCAGG - Intergenic
1102657224 12:114492173-114492195 GCTGAAAAACAAATGGAGGGAGG + Intergenic
1102796766 12:115695624-115695646 CCTGGAAAAGAAAAGCAAGATGG + Intergenic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104508195 12:129352372-129352394 TCTTGAAAGTAAAAGGAGGAAGG - Intronic
1104704802 12:130935032-130935054 CCTACAAAACAAAAGAAGGAAGG - Intergenic
1104729505 12:131097255-131097277 TCTGGAAAACAAGAGGGTGATGG + Intronic
1105344874 13:19562384-19562406 CATGTAAAATAAAAGGAGTAGGG + Intergenic
1105580604 13:21692284-21692306 CATGGAAAACGAAAGAAGGGGGG - Intronic
1105852092 13:24344145-24344167 ATTGGAAAACAAAAAGAGGCAGG + Intergenic
1106139400 13:26998995-26999017 CCAGGAAAACAGAAAGAGCAGGG + Intergenic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1106563186 13:30863996-30864018 CCTGGCAAAGGAAAGGAGGGAGG - Intergenic
1106794298 13:33188350-33188372 CCTGGAAAACAGTAGGTGTATGG + Intronic
1107328749 13:39274072-39274094 CCTGGTAATGAAAATGAGGAAGG + Intergenic
1107701672 13:43054936-43054958 CCTGGAGCACAGAAGGAGGGCGG + Intronic
1107750786 13:43563947-43563969 TCTGGAAAAAAAAAGGAGGAAGG + Intronic
1107814619 13:44233108-44233130 CCTGGAGAGCTAGAGGAGGATGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108540805 13:51442890-51442912 TCTGCCAAACAAAGGGAGGAAGG + Intronic
1108657522 13:52549835-52549857 CATGGAAAACAAAACAAGGCAGG - Intergenic
1108752734 13:53464773-53464795 CCAGGAAAACAAAGAGAAGAAGG + Intergenic
1108847700 13:54696508-54696530 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
1109614414 13:64811111-64811133 CCTAGAACACAAAAGGATGGGGG + Intergenic
1109662944 13:65489467-65489489 GCTGCAAATCAAAAGCAGGAAGG - Intergenic
1110051690 13:70910089-70910111 CTTGGAAAAAAAAAGAAGGATGG - Intergenic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1110136448 13:72073366-72073388 CCTGGCAAAAATAAGGAAGAAGG + Intergenic
1110324957 13:74202961-74202983 ACTGGTAAAGAACAGGAGGAAGG + Intergenic
1110688601 13:78404664-78404686 CCTGGAAAACAGAAGTGGAAAGG + Intergenic
1110911617 13:80972713-80972735 TTTGGAACACAAAAGGTGGAAGG - Intergenic
1113162619 13:107399190-107399212 ACTGGGAAACAAATGGAGGTAGG + Intronic
1113166520 13:107449353-107449375 CCTGAAAATCAAAAGTAGGAAGG + Intronic
1113402288 13:110005152-110005174 ACTGGGAAACAAGAGGAGGCTGG + Intergenic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114843499 14:26293286-26293308 CATGAAAAATAAAAAGAGGAGGG + Intergenic
1115412406 14:33090315-33090337 AATGGAAAACAAAAGAAGGCAGG + Intronic
1115569162 14:34650783-34650805 CCAGGAAAAAAAAAGAAAGAAGG - Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1115845219 14:37524013-37524035 CTTGGAGCAAAAAAGGAGGATGG + Intronic
1115931437 14:38500786-38500808 GCTGAAAAACTCAAGGAGGAGGG - Intergenic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116666682 14:47785330-47785352 CGTAGAAAACAGAATGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117574643 14:57085875-57085897 ACTGGAAAACAAAAGAGAGATGG + Intergenic
1118096038 14:62538008-62538030 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1118104174 14:62638860-62638882 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1118143411 14:63109952-63109974 TCTGGCAAACAAAATAAGGAAGG - Intergenic
1118521098 14:66586213-66586235 AATGGAAAACAAAAAAAGGAAGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118932168 14:70252963-70252985 CCTGAGAGACAAAAGGGGGAAGG - Intergenic
1119344341 14:73910121-73910143 CTTGGAAAACAAGATGGGGAAGG + Intronic
1119699851 14:76746592-76746614 ACTGGAAAACAAAAAAAGGCAGG + Intergenic
1119793527 14:77376235-77376257 CCTGGACAAGAAGAGGATGAGGG + Intronic
1119903202 14:78279189-78279211 TGTGGAAAAAAAAAGCAGGATGG + Intronic
1120623994 14:86802162-86802184 TCTGGAAAAGAACAGGAGAAAGG + Intergenic
1120709550 14:87779277-87779299 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1121591834 14:95120593-95120615 GCTCAAAAACAAAAGGATGAGGG + Intronic
1121593838 14:95143366-95143388 TCTGGAAAAGAAAAGGGGAAAGG - Intronic
1121599474 14:95192340-95192362 CCTATAAAATAAAAGCAGGAAGG - Intronic
1122233699 14:100320343-100320365 GATGGAAGACAAACGGAGGAGGG - Intergenic
1123127579 14:105959945-105959967 ACTGGAAAACAAAAAAAGGCAGG - Intergenic
1123205343 14:106707317-106707339 ACTGGAAAACTAAAGGACAAAGG - Intergenic
1123210387 14:106754584-106754606 ACTGGAAAACTAAAGGACAAAGG - Intergenic
1123822586 15:24045492-24045514 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1124841495 15:33246019-33246041 CATGGAAAACAAAATAAGGCTGG - Intergenic
1124955017 15:34354619-34354641 GATGGAAAACAAGAGGAAGAAGG + Exonic
1125123950 15:36197551-36197573 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1126022335 15:44414279-44414301 CATGTAAAATAAAAGGAGTAGGG - Exonic
1126352562 15:47759723-47759745 CCTGGAAAACAGAAGCAGTTTGG - Exonic
1126512719 15:49498789-49498811 AATGGAAAACAAAAAGAGCAAGG + Intronic
1126622018 15:50649822-50649844 GGTAGAAAACAAAAAGAGGAGGG + Intronic
1126892356 15:53219980-53220002 CATGGAAACCAAAAGTAGAATGG - Intergenic
1127467003 15:59253925-59253947 CCAAGAAAACAAAAAGGGGAAGG + Intronic
1127481871 15:59385156-59385178 CCTCAAAAACAAAAGGAGGCTGG - Intronic
1127539750 15:59925353-59925375 CCAAAAAAAGAAAAGGAGGAGGG + Intergenic
1127918052 15:63471679-63471701 CCAGGCAGACAATAGGAGGAAGG + Intergenic
1128323689 15:66709445-66709467 CCTGGGACTCAAAAGGTGGAAGG - Intronic
1128740875 15:70082926-70082948 CCTGGAAGAAAAGAGGAGGTGGG - Intronic
1129148452 15:73671009-73671031 CCTGAGAAACAAAAGGTAGATGG - Intergenic
1129601404 15:77000840-77000862 ACTAGAAAAAAAAAGGAGGGAGG - Intronic
1129746412 15:78024539-78024561 CCTGGGAGCCAAAAGGAGAATGG + Exonic
1130980866 15:88811067-88811089 CTTGGAGAACCAAGGGAGGAAGG - Intronic
1131159452 15:90095254-90095276 CCTAGAGAACAAAAGGTGGCTGG + Intronic
1132123443 15:99197962-99197984 CCAGGAAAACAAGAGGAAAAGGG - Intronic
1132397559 15:101485745-101485767 TCTGGGAAAGAAGAGGAGGAGGG - Intronic
1133120565 16:3604244-3604266 CATGGAAAACAAAAGGAAATGGG + Intronic
1133600875 16:7339176-7339198 GCTGCAAAACAAAAGCAGGAAGG + Intronic
1133641795 16:7724262-7724284 CCAGACAAACATAAGGAGGAAGG - Intergenic
1136187499 16:28596827-28596849 CCCGGAAAAAAAAAAAAGGAAGG + Intronic
1136659704 16:31746723-31746745 CCTGAAAAACATGAGGAGAATGG - Intronic
1136992442 16:35162332-35162354 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1138271813 16:55701148-55701170 GCAGGTAAACAAAATGAGGATGG + Intronic
1139354585 16:66360016-66360038 CCTGGAAAACAATAGGTTGGAGG - Intergenic
1139670102 16:68486960-68486982 CCTGGCTGACAAAGGGAGGAGGG - Intergenic
1139820473 16:69717127-69717149 CCTGGAAACCACGAGGAGGGTGG - Intronic
1139844348 16:69909047-69909069 TCTGGGAAACAAAAGGCGCATGG + Intronic
1140033478 16:71356404-71356426 CCAGGAAAACCAAAGTAGCATGG + Intergenic
1140196306 16:72858409-72858431 CCGGCAAAACAAAAAGAGGGGGG + Intronic
1140334366 16:74090723-74090745 TCTGGAAGACAAAAGGAAGGAGG - Intergenic
1140847399 16:78903561-78903583 CCTAAGTAACAAAAGGAGGAGGG - Intronic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1141496065 16:84410546-84410568 CCTAGACAGCAAACGGAGGAGGG - Exonic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142781009 17:2181223-2181245 TATGGGAAACAAAAGAAGGAAGG + Intronic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1143654528 17:8286094-8286116 CATGGGAAACAAAAGGAGCCAGG - Intergenic
1144616741 17:16782950-16782972 CCTGAAAAAGACAAGGAGAATGG - Intronic
1144895950 17:18532711-18532733 CCTGAAAAAGACAAGGAGAATGG + Intergenic
1145136263 17:20411509-20411531 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1146837336 17:36122573-36122595 ACTGGGACACAAAAGGAGGCTGG - Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147756889 17:42774478-42774500 CCTGGATATTCAAAGGAGGAAGG - Intronic
1147885840 17:43683850-43683872 CCTGTAAAATAAAAGGCAGATGG + Intergenic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148454619 17:47804481-47804503 CCTGGATGAGCAAAGGAGGATGG - Intergenic
1148666518 17:49379007-49379029 CCTGGAAGAGAAAAGGGGAAGGG + Intronic
1150454574 17:65296645-65296667 CCAGGAAAACAAGAGTAGCATGG - Intergenic
1150663422 17:67107003-67107025 CCTGAAATACAATAGGAGGGTGG + Intronic
1151161690 17:72171265-72171287 CCTGGCAGTCAAAGGGAGGAGGG - Intergenic
1151874484 17:76859118-76859140 GCTGGAAAAGGAAAGGAGGTAGG - Intergenic
1153108654 18:1558798-1558820 AATGGAAAACAAAAAGAGTAAGG - Intergenic
1153229126 18:2920142-2920164 CCTGGGAAGGCAAAGGAGGATGG + Exonic
1153847807 18:9065522-9065544 AATAGAAGACAAAAGGAGGAAGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155489292 18:26383463-26383485 CCTTGAAATGAAGAGGAGGAAGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1157023929 18:43820069-43820091 ACATCAAAACAAAAGGAGGATGG + Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157416504 18:47507818-47507840 CCTTGAAAACAACACAAGGAGGG + Intergenic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1158206990 18:55004383-55004405 CCTGCAAGAATAAAGGAGGATGG + Intergenic
1158568211 18:58573936-58573958 CCTGGAAAACATGTGGTGGATGG - Intronic
1159911345 18:74149022-74149044 CCCCGAAAAGCAAAGGAGGATGG + Exonic
1161003267 19:1921815-1921837 CCAGAAAAAAAAAAAGAGGAAGG + Intronic
1161010377 19:1956973-1956995 CCTGGAAGAGAGAAGGAGGGAGG + Intronic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1163755738 19:19105343-19105365 CCCAGAAAACATAGGGAGGAAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1163940944 19:20492762-20492784 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1164420761 19:28089950-28089972 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1164524270 19:29001865-29001887 CCAGGAAGACAAGATGAGGAAGG - Intergenic
1164563853 19:29312076-29312098 CCTGAAAAACCCTAGGAGGAGGG - Intergenic
1164695941 19:30244385-30244407 CCTGGAAAACAAAGGAAGACAGG - Intronic
1164783061 19:30909103-30909125 CCTAGAGAACAAGAGGAGGGAGG + Intergenic
1165035812 19:33032843-33032865 CCTGGCAGGCAATAGGAGGAAGG - Intronic
1166064445 19:40348804-40348826 CGTGGAAGACAACACGAGGAGGG - Intronic
1166404720 19:42511877-42511899 CCCGGAAAACAAAATGGGAAAGG - Intronic
1168195219 19:54769891-54769913 CCTGGAAAGCAATAGAGGGAGGG + Intronic
1168370037 19:55824581-55824603 AATGGAAAACAAAAAAAGGAAGG + Intronic
925027858 2:623748-623770 CCTCTAAAGCAAATGGAGGATGG + Intergenic
925172969 2:1762228-1762250 AATGGAAAACAAAAGAAGGCAGG + Intergenic
925334520 2:3084681-3084703 AATGGAAAACAAAAGAAGGCAGG + Intergenic
926289549 2:11517501-11517523 ACTTGAAAAAAAAAAGAGGAAGG + Intergenic
926384526 2:12323295-12323317 AATGGAAAAAAAAAGGAGCAGGG - Intergenic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926855571 2:17252258-17252280 TCTGGAAGAGAAAATGAGGAGGG - Intergenic
927279742 2:21294140-21294162 CCTGCAAAACAGAAGGATTAGGG - Intergenic
927426449 2:22986340-22986362 AATGGAAAACAAAAGAAGGCAGG + Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
929835502 2:45393286-45393308 CCTGAAAAAGAAAAGGCTGAGGG + Intronic
930385705 2:50692112-50692134 CTTGGAAAATAAAAGAAGGAGGG - Intronic
930709854 2:54540451-54540473 CCTGGAGCACAAAAGAAGGCAGG - Intronic
930712489 2:54562019-54562041 TCTGAAAAAGAAAAAGAGGAAGG - Intronic
930721685 2:54644301-54644323 CCTGGAAAACAAAACCAACATGG - Exonic
933009478 2:77041074-77041096 GCTGGAAAGTATAAGGAGGAAGG - Intronic
933279824 2:80321241-80321263 CCTGGAAAAAAAAAGGAAATTGG + Intronic
933404616 2:81842233-81842255 AATGGAAAACAAAAGAAGGCAGG + Intergenic
938418676 2:131125731-131125753 CCTGGAAAAAAAAAATAGTACGG - Exonic
938565355 2:132514009-132514031 TCTTGAAAAGAAAAGAAGGAAGG - Intronic
938828080 2:135026495-135026517 TTTTGAAAAAAAAAGGAGGAGGG - Intronic
939724936 2:145706761-145706783 CCAGGAACACAAAATGGGGAAGG - Intergenic
939975008 2:148707165-148707187 AATGGAAAACAAAAAGAGGCAGG + Intronic
940812027 2:158255292-158255314 CCAGGAAAAAAAAAGGGGGGCGG + Intronic
940921945 2:159317274-159317296 GCTGGAAAAGAGAAGGAGCATGG + Intergenic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
941520841 2:166540269-166540291 AATGGAAAACAAAAGTTGGAGGG + Intergenic
942076218 2:172359241-172359263 CCTAGAAAACTAATGCAGGAGGG - Intergenic
942086501 2:172449065-172449087 CCTGGGAAGTGAAAGGAGGAGGG + Intronic
942498585 2:176564715-176564737 ACTGGAAACCAAAATGAGAATGG + Intergenic
942988442 2:182169850-182169872 CATGGACAACAAAAGTAAGAAGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943720943 2:191203045-191203067 CCTGGAAAAAAAGAGGATAAAGG - Intergenic
943788531 2:191905951-191905973 CCTGGAAAAGAACATGAGGCAGG + Intergenic
944455932 2:199894020-199894042 CCTGGAAAACAAGGAGAGAAAGG - Intergenic
944472460 2:200069074-200069096 TCCAGAAAACTAAAGGAGGAGGG + Intergenic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945212401 2:207397441-207397463 CATGGAAAAGGAAAGGAGGGTGG + Intergenic
946396549 2:219446245-219446267 CCTGGTAAAGAAAGGCAGGAAGG - Intronic
946881102 2:224177886-224177908 CCTGGAAACTAAAAGCTGGATGG - Intergenic
946946853 2:224830239-224830261 CCTGTAAATGAAAAGGGGGAAGG - Intronic
947185670 2:227453204-227453226 CCTGGAAAAAAAAAAAAAGAAGG - Intergenic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947602036 2:231458422-231458444 CCTGAAAAACCAAAGGTGGGGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947820913 2:233068873-233068895 CCTGGAAGCCAGCAGGAGGAAGG + Intronic
948764394 2:240212093-240212115 TCTGGAAAACAAGAGGTGGCTGG + Intergenic
1169178366 20:3539758-3539780 CCAGGAAAAAAAAAGTGGGAGGG - Intronic
1169189665 20:3650129-3650151 CCTGGGAAATAAAAAGAGCAGGG + Exonic
1169516207 20:6319644-6319666 AATGGAAAACAAAAAAAGGACGG - Intergenic
1169557395 20:6766211-6766233 CCAGGAAAATAAAAGGGGGTGGG - Intergenic
1169605651 20:7315844-7315866 CCTGGGAGACAAAAGTGGGAGGG + Intergenic
1169714329 20:8598924-8598946 CATGGAAAACAAAAAAAGGCAGG - Intronic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1171330211 20:24330831-24330853 CCTGGAAAATAAACACAGGATGG + Intergenic
1171985120 20:31654809-31654831 CCTGGAAAACAAACTGTAGAGGG - Intergenic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173062407 20:39675044-39675066 CCTCGAGAACAGAAAGAGGAAGG - Intergenic
1173177286 20:40773836-40773858 TGGGGAAAACAACAGGAGGAAGG + Intergenic
1173210093 20:41025643-41025665 CCTGGAAAGCAAATGCAGGCTGG + Intergenic
1173552236 20:43940562-43940584 CCTGGAAAATAAATGGGGGAGGG + Intronic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1174973073 20:55299841-55299863 GTTGGGAAATAAAAGGAGGATGG + Intergenic
1175140547 20:56857643-56857665 CCTTGAAAAAGAAAGGAGAAAGG + Intergenic
1175273990 20:57754904-57754926 GAAGGAAAAAAAAAGGAGGAAGG - Intergenic
1175287350 20:57845753-57845775 CTTAGAAGAGAAAAGGAGGAGGG + Intergenic
1175384554 20:58585848-58585870 CCTGGAGGACACAAGAAGGAAGG + Intergenic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1176261374 20:64182642-64182664 CCAGGGATACAACAGGAGGATGG - Intronic
1176901065 21:14442824-14442846 AATGGAAAACATAAGAAGGAAGG + Intergenic
1176995248 21:15547958-15547980 TCTGGAAAACAAGAAGAGAAAGG + Intergenic
1177657238 21:24034123-24034145 TCTGAAAAACAAAAACAGGATGG + Intergenic
1177885034 21:26736651-26736673 TGTGGAAACCACAAGGAGGAAGG - Intergenic
1177969182 21:27767219-27767241 CATGGAACAGAAAAGGAAGAAGG - Intergenic
1178031724 21:28535297-28535319 GAAGGAAAACAAAAGGGGGAGGG + Intergenic
1178149791 21:29781340-29781362 CCTGGAAAATAAAAAATGGAAGG - Intronic
1178752898 21:35321326-35321348 CGAGGAAAAAAAGAGGAGGAAGG - Intronic
1179072197 21:38082119-38082141 TCTGCAAAACAAAAGGCGGTGGG - Intronic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1180178202 21:46100586-46100608 CCTGGAAACATAAAGTAGGATGG - Intronic
1180288706 22:10777044-10777066 CCTTGAGAACTAAAGGGGGAGGG + Intergenic
1180795983 22:18605663-18605685 CCAGGAAAAAAAAAGCAGAAGGG + Intergenic
1181225739 22:21389608-21389630 CCAGGAAAAAAAAAGCAGAAGGG - Intergenic
1181252895 22:21545205-21545227 CCAGGAAAAAAAAAGCAGAAGGG + Intergenic
1181321444 22:22009992-22010014 TCTAGAAAACAAAAGGATGGGGG + Intergenic
1183364497 22:37399864-37399886 CCTGGTAAATGAAAGAAGGAAGG + Intronic
1183417999 22:37693628-37693650 TCTGGAAAGCGACAGGAGGAAGG - Intronic
1183868049 22:40719822-40719844 CCTGGAAAACAAATACAGGTGGG - Intergenic
1184346242 22:43914998-43915020 GGTGCAAAACAAAAGGACGATGG + Intergenic
1185371974 22:50465129-50465151 CCTGGATGACAGAAGGAGGTCGG + Exonic
949209416 3:1479780-1479802 AATGGAAAACAAAAGTAGGCAGG + Intergenic
949499994 3:4670707-4670729 CCTAGAAAACAAGAGGAGGAGGG - Exonic
949600635 3:5594614-5594636 AATGGAAAACAAAAAGAGGCAGG - Intergenic
949672222 3:6412356-6412378 CCTTGAAAAAAAAAGGAAGATGG + Intergenic
950040486 3:9916521-9916543 CCTCCAAAAGCAAAGGAGGATGG + Intergenic
950332566 3:12168195-12168217 TCTGGAAAACAGATAGAGGAGGG + Intronic
951505259 3:23437719-23437741 CGTAGAAATCCAAAGGAGGAGGG - Intronic
951939457 3:28061417-28061439 AATGGAAAACAAAAGAAGGCGGG + Intergenic
953110633 3:39934574-39934596 CATGCAAAACTAAAGAAGGAAGG - Intronic
953153077 3:40343103-40343125 AATGGAAAACAAAAGAAGCAGGG - Intergenic
953551028 3:43903137-43903159 CCTGCAAAGCAAAAGGGGCATGG + Intergenic
953843115 3:46405871-46405893 TCTGGAAAAAAAAAAGAAGAAGG - Intergenic
954279506 3:49566217-49566239 ATTTGAAAACAAAAGGAGCAAGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954518519 3:51201342-51201364 AATGGAAAACAAAAAAAGGAAGG + Intronic
954995693 3:54879556-54879578 TCTGGAAAACAAAAGCAGCCTGG - Intronic
955207321 3:56908092-56908114 GCTGGGCAACAAAAGGAGAAAGG + Intronic
955341331 3:58127770-58127792 CCCCCAAAACAAATGGAGGAGGG - Intronic
955878920 3:63523212-63523234 ACTGGAACAGAAAAGGAGAAGGG + Intronic
956394681 3:68812492-68812514 AATGGAAAACAAAAGAAGGCAGG + Intronic
956426900 3:69145193-69145215 CCAGGCAGAAAAAAGGAGGAGGG + Intergenic
956557618 3:70540368-70540390 TCTGGAAGTCAAAGGGAGGAAGG - Intergenic
956792818 3:72693255-72693277 CCTGTGAAGCAAAAGGAGAAAGG + Intergenic
956919513 3:73912255-73912277 CCTGGAGCCCAAAAGAAGGACGG - Intergenic
957624926 3:82644302-82644324 TCTGGAAGTCAAAGGGAGGAAGG + Intergenic
959030935 3:101299007-101299029 CCTGAAAAAGACAAGGAGAAAGG - Intronic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960254832 3:115500967-115500989 TCTGGAAAACAGTGGGAGGAAGG + Intergenic
960651757 3:119958687-119958709 CCTGGAAGAAAAAAAAAGGATGG + Intronic
961549981 3:127664181-127664203 CATAGAAACCAAAAGGAGAATGG - Intronic
962194581 3:133350597-133350619 TCTAGAAAACAAATGGAGAAAGG + Intronic
962207850 3:133449881-133449903 CCTGTCAAAAAAAAGAAGGAAGG + Intronic
962424272 3:135256042-135256064 AATGGAAAACAAAAGAAGGCAGG - Intronic
962803634 3:138911124-138911146 GCTGGAAAATAGAAGTAGGAAGG - Intergenic
963226612 3:142868950-142868972 CCTGGATTCCAAAGGGAGGAGGG - Intronic
963360281 3:144263906-144263928 CCTGGAAAAAAAAATTAGAAAGG + Intergenic
963484623 3:145920204-145920226 AATGGAAAACAAAAAAAGGAAGG + Intergenic
963557251 3:146807698-146807720 TCTGGTAAAGAAAAGCAGGAAGG - Intergenic
964463915 3:156968443-156968465 AATGGAAAACAAAAGAAGGCAGG + Intronic
964780444 3:160331308-160331330 CCTGGGAAAACAAAGTAGGATGG + Intronic
964921621 3:161903641-161903663 CTAGGAAAAAAAAAGGTGGAGGG - Intergenic
965413864 3:168367608-168367630 ACAGGAAAAGAAAAGGTGGAGGG + Intergenic
965727715 3:171736662-171736684 CCTCCAAAAGACAAGGAGGAAGG + Intronic
965760479 3:172070069-172070091 CCTGGAAAGAAAAGGGAGCAGGG - Intronic
965792234 3:172402132-172402154 GCTGAAAAAAAAAAGGGGGAGGG - Intergenic
965852335 3:173043189-173043211 ACTGGAAAACAGAAGCATGATGG - Intronic
966607508 3:181836109-181836131 CCTGGAAAACTAGAGGAGAATGG - Intergenic
967232366 3:187352317-187352339 CATGGAAAACCAAAGCAGGAGGG - Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
967881785 3:194306603-194306625 CCAGGAAAACAACGAGAGGAAGG - Intergenic
968378418 4:65296-65318 CCTGGAAAACGGAAGTAGAAAGG - Intronic
968419044 4:467442-467464 CCTAGAAAACATAAGTAGAATGG + Intronic
969399385 4:6943765-6943787 CTCGGAAAACCACAGGAGGACGG - Intronic
969567541 4:7987669-7987691 CCTGGAATACCAAAGGAAGCTGG - Intronic
970244264 4:14042158-14042180 GCTGGAAAAAGAAAGGAGAAGGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
970639380 4:18047368-18047390 TCTGTAAAACAAAAGAAGGGGGG - Intergenic
971689209 4:29811310-29811332 CCTGAAATCCAAAGGGAGGAAGG + Intergenic
972086488 4:35223478-35223500 ACTGGAAAAGAAAAGGGGCAAGG + Intergenic
972969620 4:44557186-44557208 GCAGCAAAACAAATGGAGGAAGG - Intergenic
973258924 4:48141419-48141441 CCTGGAAAACAACATTATGATGG + Exonic
974143717 4:57920387-57920409 AATGGAAAACAAAAAAAGGAAGG + Intergenic
974236152 4:59184154-59184176 CTTGGAAAACAAAAAAAGGCAGG - Intergenic
974238210 4:59208770-59208792 AATGGAAAACAAAAAGAGGCAGG + Intergenic
974356450 4:60818946-60818968 CATGGAAAAATAAATGAGGAAGG - Intergenic
974396156 4:61337547-61337569 ACAGGAAAAGAAAACGAGGAAGG - Intronic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
975284023 4:72596022-72596044 AATGGAAAACAAAAAAAGGAAGG + Intergenic
976492789 4:85691660-85691682 TATGGAAAACAAAAAGAGCAAGG - Intronic
976575161 4:86661513-86661535 TCTCAAAAAGAAAAGGAGGAAGG - Intronic
976718225 4:88145963-88145985 TGTGGAGAACAACAGGAGGAGGG + Intronic
976839910 4:89419978-89420000 CCTGAAAGATGAAAGGAGGAAGG + Intergenic
977650679 4:99465057-99465079 CCAAGAAAACACAACGAGGAAGG - Intergenic
977869403 4:102072036-102072058 TGTGGAAAAGAAAAGGAAGAAGG + Intronic
978285232 4:107069942-107069964 CCAGGAAAATAAAAGGAGAAGGG + Intronic
978861594 4:113456514-113456536 ACTGAAAAAGCAAAGGAGGATGG - Intronic
979124784 4:116955819-116955841 GGTGGCAAACAAAAGGAGGCTGG - Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
980424719 4:132613119-132613141 CGAGGAAAAGAAAACGAGGAAGG + Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
980872687 4:138627435-138627457 CCTGGAAAACACAGGGATCAGGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981188711 4:141835922-141835944 AATGGAAAACAAAAAAAGGAAGG + Intergenic
981323524 4:143420352-143420374 CCCTGAAAACAAAAGGAAAAGGG + Intronic
981459987 4:145001996-145002018 CATGGAAAATAAAAGAAGGAAGG + Intronic
981627756 4:146778809-146778831 CCTGGACTCCAAAAGGAAGAAGG + Intronic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
981983819 4:150829573-150829595 CAAGGAAAACAAAAAGAGAATGG - Intronic
982191045 4:152855578-152855600 CCTGAAAAACAAGAGAAGCATGG - Intronic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982461633 4:155676786-155676808 ACTGGAAAACAAAAAAAGGTTGG - Intronic
982628357 4:157798010-157798032 ACTGGAAACCAACAGGTGGATGG - Intergenic
982653292 4:158114502-158114524 CATGGAAAAGCACAGGAGGAGGG + Intergenic
982781830 4:159499324-159499346 ACTGTAAAACAAAATTAGGATGG + Intergenic
982836321 4:160124039-160124061 AATGGAAAACAAAAAAAGGAAGG - Intergenic
982838636 4:160154996-160155018 AATGGAAAACAAAAAAAGGAAGG - Intergenic
983099609 4:163608741-163608763 CCAGGAACAGAAAAGGAAGAAGG + Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985236969 4:187885618-187885640 CCAGAAAAAGAAAGGGAGGAAGG - Intergenic
986047839 5:4057791-4057813 CTTGGAAAACACCAGCAGGATGG - Intergenic
986146127 5:5079448-5079470 TCCCGAAAACAAGAGGAGGAAGG + Intergenic
986764925 5:10916722-10916744 GCTGGAAAGAAAAGGGAGGATGG + Intergenic
986922891 5:12709216-12709238 TCTGGAAGAGAGAAGGAGGATGG + Intergenic
987533299 5:19149676-19149698 CGGGGAATCCAAAAGGAGGAAGG + Intergenic
987547359 5:19329578-19329600 CGTGGAATAGAAAAGAAGGATGG - Intergenic
987678832 5:21109593-21109615 AATGGAAAACAAAAAAAGGAAGG + Intergenic
987866035 5:23540357-23540379 CCCTGAAAACAAAAGGAAGAAGG - Intergenic
989662177 5:43811998-43812020 CATGGAAAACAAAAAAAGGCAGG - Intergenic
989693043 5:44168842-44168864 AATGGAAAACAAAAAGAGCAGGG - Intergenic
990077072 5:51860404-51860426 CCTCTAAAACAAAAGATGGAAGG - Intergenic
990772898 5:59269914-59269936 CCTGTAAAATAAAAGGGGCAAGG - Intronic
991101906 5:62802795-62802817 AATGGAAAACAAAAAAAGGAAGG - Intergenic
991318579 5:65341098-65341120 CCTGAATAACAAATGGATGAAGG + Intronic
991365078 5:65859836-65859858 CCTGGAACACAAAGGTTGGAGGG + Intronic
991535397 5:67664658-67664680 CATGGAAAACAAAAAAAGGCAGG - Intergenic
992154913 5:73945491-73945513 CATGGAAAAGAAAAAAAGGAGGG + Intergenic
993272005 5:85808756-85808778 CCTGAATTTCAAAAGGAGGAGGG + Intergenic
993289919 5:86053874-86053896 ACTGGAGAACAATAGGTGGAAGG - Intergenic
993344980 5:86771500-86771522 CCAGAAAAAGAAAAGAAGGAAGG + Intergenic
993439035 5:87932500-87932522 CTCTGAAAACAAAAAGAGGAAGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994290626 5:98024919-98024941 AATGGAAAACAAAAAGAGGCAGG + Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
994942006 5:106336019-106336041 CATGGAAATCAACAGGAGAAAGG + Intergenic
995204140 5:109459558-109459580 AATGGAAAACAAAAAAAGGAAGG + Intergenic
996155794 5:120098440-120098462 GCTGGAGAACATACGGAGGAAGG - Intergenic
996219034 5:120906257-120906279 CATAGAAAACAAAAGCAAGAAGG - Intergenic
996489503 5:124077266-124077288 CCTGAACAACCAAAGGATGAAGG - Intergenic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997237757 5:132283701-132283723 TCTGGAAATCAAAAGGCGAATGG - Intronic
998087582 5:139339332-139339354 CATGGAAAACAAAATAATGAAGG - Intergenic
998502909 5:142648945-142648967 CCAGGAAAACAATAGCAGGACGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998974141 5:147625680-147625702 CCTGGATTACACAAGTAGGAAGG - Intronic
1000681966 5:164196270-164196292 CCTGGAAAATTTAAGGAGGTTGG - Intergenic
1000694491 5:164363080-164363102 CCTGAAGAAGAAGAGGAGGAGGG - Intergenic
1000899906 5:166900292-166900314 CCTGAAAAAAAAAGGAAGGAAGG + Intergenic
1001282494 5:170397104-170397126 CCTGAATACCAAAGGGAGGAAGG + Intronic
1001711303 5:173780559-173780581 TTTGGAGAACAAAAGGAGGAAGG - Intergenic
1002113247 5:176935874-176935896 CCTGGAAAAATAATGGTGGATGG - Intronic
1002644945 5:180648554-180648576 CCTGGAAATCAAAGGGTGTAAGG - Intronic
1002923005 6:1586486-1586508 CCTTGAAAACAAGAGGAAGGAGG - Intergenic
1002937680 6:1687553-1687575 CCTGGAACACAGGAGAAGGACGG - Intronic
1003459938 6:6320245-6320267 GCTGGAACACAAAAGGTGGAGGG - Intronic
1003480947 6:6532609-6532631 CCTGCAAAACTCAAGGATGAAGG - Intergenic
1003707751 6:8553597-8553619 TTAGGAAAAAAAAAGGAGGAGGG + Intergenic
1003726744 6:8774316-8774338 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1004405252 6:15327151-15327173 CCCAAAAAAGAAAAGGAGGAAGG - Intronic
1006152379 6:31996407-31996429 CCTGGAAGAAAACGGGAGGAGGG - Exonic
1006155958 6:32012920-32012942 ACTGGAAAACAAAATGAGCGGGG - Intergenic
1006158680 6:32029145-32029167 CCTGGAAGAAAACGGGAGGAGGG - Exonic
1006162291 6:32045774-32045796 ACTGGAAAACAAAATGAGCGGGG - Exonic
1006933789 6:37703531-37703553 CCTGGAATACAAATGGAGCCAGG + Intergenic
1006938198 6:37733041-37733063 TCTGCAAGACAAAGGGAGGAAGG - Intergenic
1007246336 6:40465906-40465928 CCTGGAAAAGAAAAGGTTGTGGG + Intronic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007714258 6:43845254-43845276 CCTGGAAAGGAAAAGAAGGAGGG - Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008455412 6:51705216-51705238 CTTGAAAAATCAAAGGAGGATGG + Intronic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1009406114 6:63314656-63314678 TCTGGATAAGAAAAGGTGGAGGG + Intronic
1009869525 6:69435982-69436004 CCTGGAACACAAAGTGTGGAAGG + Intergenic
1009905748 6:69867808-69867830 GCTGGAGAGCAAAAAGAGGAGGG + Intronic
1010060284 6:71614847-71614869 CCTGGAGTAGAAATGGAGGATGG - Intergenic
1010767651 6:79794710-79794732 CCTGGAAAACTGAGGCAGGAAGG + Intergenic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1012081197 6:94760075-94760097 ACTGGAAAACAAAAAAAGGCAGG + Intergenic
1012086008 6:94826464-94826486 ACTGGAAAACAAAAAAAGGCAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012540572 6:100356886-100356908 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1013167993 6:107610956-107610978 CCTGGAAAACAAAATGATTCTGG + Intronic
1013509643 6:110832801-110832823 CCTAAAAAACAAAAAGTGGATGG - Intronic
1013687181 6:112599199-112599221 TCTGGAAAACAAAATGAAGAGGG + Intergenic
1014376355 6:120679964-120679986 CCTGGAAAAGTAAAGGAGTCAGG + Intergenic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015392998 6:132703879-132703901 AATGGAAAACAAAAGGAGCAGGG + Intronic
1015409773 6:132880306-132880328 ACTGGAAAGCAAAAGTTGGAAGG - Intergenic
1016544238 6:145202592-145202614 CCTGGGAAACATAAGAAGGGAGG - Intergenic
1017373918 6:153744744-153744766 GCTGGAAGATAAAAGGAGGCTGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017741277 6:157408995-157409017 GATGGAAAAGAAAAGAAGGAGGG + Intronic
1018181252 6:161225562-161225584 ACTAGAAAAGAAAAGAAGGAAGG + Intronic
1018252042 6:161881168-161881190 CCTGGAAAACAGATGTTGGAGGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018423709 6:163662078-163662100 CCAGGTAAACAAGAGAAGGAAGG + Intergenic
1018542897 6:164902197-164902219 TCTTGAAAACAAAAGCAGGCTGG + Intergenic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1020341770 7:7118708-7118730 CCTGGAAAATAAAAAGAGAGAGG - Intergenic
1020685276 7:11286094-11286116 CCAGAAAAAGGAAAGGAGGAAGG - Intergenic
1020799963 7:12721118-12721140 ACTGGAAAAAACAAGGAAGAAGG - Intergenic
1020979310 7:15047585-15047607 CATGGACAACAAAAAGAGAAAGG + Intergenic
1021078341 7:16332722-16332744 ACTGGAAAACAAAAATAGCAAGG + Intronic
1021390368 7:20085603-20085625 CCTGGAAGACAAGTGAAGGAAGG + Intergenic
1021814639 7:24435350-24435372 CATGGAAAATAAAAGTAGAAGGG + Intergenic
1021816113 7:24449160-24449182 CCTGGAAACTAAAAGAAGCAAGG - Intergenic
1021915605 7:25429317-25429339 AATGGAAAACAAAATGAGAATGG - Intergenic
1022015245 7:26343844-26343866 CCAGGAAAGCAAAAGGAAAAAGG - Intronic
1022099017 7:27158126-27158148 CCAGGAATACAAAAGGTGGAGGG + Intergenic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1022871882 7:34488585-34488607 CCTGGAAAAAAAAAATAGGCTGG - Intergenic
1023388138 7:39681031-39681053 CCTGGAACATAACAGGAGCAGGG - Intronic
1023609475 7:41958596-41958618 CCTGCATAAGAAAGGGAGGAGGG - Intergenic
1023963306 7:44946109-44946131 CCCAGAAAACAAAAGCAAGATGG + Intergenic
1024010470 7:45261954-45261976 CCTGGAAGCAAAAAGGAGGAGGG - Intergenic
1024408215 7:49007429-49007451 ACTGGAAAACAAAAAAAGGCAGG - Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1025721795 7:64022950-64022972 CCTGGCTAAAAAAAGTAGGAGGG + Intergenic
1026355292 7:69552092-69552114 CCAGGCAAACAAAATGAAGAAGG + Intergenic
1026358075 7:69577247-69577269 TCTAGAAAACAAAAGGAGTGGGG - Intergenic
1026700152 7:72634171-72634193 CCAGAAAAAAAAAAGGAGGTGGG - Intronic
1027305548 7:76892587-76892609 CCAGGAAAAGGAAAGGAGGAAGG - Intergenic
1027447424 7:78290270-78290292 AATGGAAAACAAAAAGAGCAGGG + Intronic
1027597687 7:80195809-80195831 CCTGAAAAACAAAAAAGGGAAGG - Intronic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1028111124 7:86942698-86942720 CCTGGAAAGCAAAAGGTGTTTGG - Intronic
1028295508 7:89124897-89124919 CCTGATAGACAAAAAGAGGATGG - Intronic
1028562126 7:92187565-92187587 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1028575126 7:92340516-92340538 CCAAGAAAAAAAAAGGATGAGGG + Intronic
1028953463 7:96663143-96663165 CCAGGAAAAAAAAAAGTGGAGGG + Intronic
1029408643 7:100393792-100393814 CCTGGCAAAAAATAGGAGGAAGG + Intronic
1029509050 7:100981828-100981850 CCTGGAAGCCACAAGGAGAAGGG - Intronic
1029535203 7:101154022-101154044 CCTGGAAAACAGAAAGACAAAGG - Intergenic
1030799535 7:113832221-113832243 CCTGGAAAGACAAAGGAGGAAGG + Intergenic
1030983245 7:116210713-116210735 CCTGGAAAACAAAGTGAAGAAGG + Exonic
1031482301 7:122293018-122293040 CCTGGTAAACTAAAGGAGTATGG - Intergenic
1032171030 7:129584744-129584766 CCTGGAAAAAAAGATGAGAAGGG + Intergenic
1032722151 7:134558976-134558998 TCTGGACAACAGAAAGAGGATGG + Intronic
1032732587 7:134658326-134658348 TCTGGAAAACAAAAAGAAGATGG - Exonic
1033606858 7:142933829-142933851 CCTGGGGAAGAAAAGGAGGAGGG + Intergenic
1034060136 7:148079810-148079832 CCTGGATTCCAAAGGGAGGAGGG + Intronic
1034223863 7:149467452-149467474 CCTGGATTCCAAAAGAAGGAGGG + Intergenic
1034494815 7:151413411-151413433 CCCGAAGAACAAGAGGAGGAGGG + Intergenic
1034615164 7:152409984-152410006 CCTTGAGAACTAAAGGGGGAGGG + Intronic
1035711293 8:1717239-1717261 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1035873571 8:3162634-3162656 CTTGAAAAACAAAAGTAAGAGGG - Intronic
1036387348 8:8294051-8294073 CCTGGGAAAGAAGAAGAGGAGGG + Intergenic
1036734008 8:11292042-11292064 CTTGGAAAAGAAAAGAAGGAAGG - Intronic
1037298286 8:17424313-17424335 GCTGGAAAAAGAAAAGAGGAGGG + Intergenic
1038758119 8:30360776-30360798 TTTGGAAAACGAAAGGAGTAGGG + Intergenic
1039097344 8:33900870-33900892 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039718970 8:40142017-40142039 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1039813190 8:41068315-41068337 GCTGGAGAAAAAAAGGTGGAGGG + Intergenic
1039955983 8:42207581-42207603 CCTGGAAACTTAAAGGAGGCCGG - Exonic
1040094028 8:43426029-43426051 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1040651154 8:49450206-49450228 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1041645069 8:60243276-60243298 CCTGGAAAAGAGGAGGAGGGAGG - Intronic
1041889520 8:62853278-62853300 AATGGAAAACAAAAGAAGGCAGG - Intronic
1041949753 8:63488134-63488156 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1041974172 8:63778004-63778026 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1042010779 8:64242276-64242298 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1042016618 8:64320545-64320567 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1042281802 8:67064071-67064093 CCTGGAAAGAAAAATGGGGAGGG - Intronic
1042420152 8:68578902-68578924 ATTGGAAAGCAAAAGGAGTATGG - Intronic
1043107716 8:76135955-76135977 CCTGGAACACGAGAGGATGAGGG - Intergenic
1043512600 8:80964560-80964582 CCTGGACCACAAAAGAAGGCAGG - Intergenic
1044012546 8:87012534-87012556 GCCGGAAAACAAAAGGGGTAGGG - Intronic
1044026626 8:87180719-87180741 CCTGGACTAAAAAAGAAGGAAGG + Intronic
1044203167 8:89459819-89459841 AATGGAAAACAAAAGAAGGCAGG + Intergenic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1044764360 8:95556061-95556083 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1045321354 8:101084238-101084260 TCTGGGGAACAAAAGGAAGATGG + Intergenic
1045379469 8:101608957-101608979 CCTGGAAAGCACAAGGAGAGAGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045759802 8:105590933-105590955 CCAGGAAAATAAAAATAGGAGGG + Intronic
1045898182 8:107242784-107242806 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1045969276 8:108061352-108061374 AATGGAAAACAAAAAAAGGAAGG + Intronic
1046007474 8:108504122-108504144 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1046867090 8:119163222-119163244 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1046940927 8:119930810-119930832 CCTGGAAAACTAAATGAGGAAGG - Intronic
1047549440 8:125853904-125853926 TCTTGAAAACAAAAGAAGGGAGG + Intergenic
1047560323 8:125980612-125980634 CCTGAAAAAAAAAAAGAGGGGGG - Intergenic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1048507698 8:135035595-135035617 GTTAGAAGACAAAAGGAGGAGGG - Intergenic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1048803623 8:138218646-138218668 CATGTAAAAAGAAAGGAGGAGGG - Intronic
1049145726 8:141000515-141000537 CCTGAAAAACAAAAGGGGAGAGG - Intronic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049226411 8:141452895-141452917 CCTTGAAAACATTAGGCGGAGGG + Intergenic
1049276268 8:141721599-141721621 CCTGGAGACCGAAAGGAGGGTGG - Intergenic
1049345577 8:142136808-142136830 CCTGGAGAACATAAGGCGGGTGG + Intergenic
1049460439 8:142724898-142724920 CCTGAAATCCAAAGGGAGGAGGG - Intergenic
1050270829 9:3942897-3942919 ACTAGAAAACAAAAGAAGAAAGG + Intronic
1050457413 9:5847280-5847302 CCTGGACAACAGAATGAGGCTGG - Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1050943669 9:11490750-11490772 CCAGGACAACAAGAGGAGGGTGG - Intergenic
1051018987 9:12517006-12517028 CCTGAAAAACACAAGGATTAAGG + Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051324560 9:15950941-15950963 AATGGAAAACAAAAAGAGGCAGG + Intronic
1051461372 9:17320386-17320408 CATGGAAAAAAAAAGAAAGATGG - Intronic
1051959295 9:22738604-22738626 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1051987471 9:23107396-23107418 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1052408173 9:28088882-28088904 AATGGAAAACAAAAAAAGGAAGG + Intronic
1052429702 9:28350317-28350339 AATGGAAAACAAAAGAAGGCAGG + Intronic
1052451731 9:28639644-28639666 AATGGAAAACAAAAGAAGGCAGG - Intronic
1052820127 9:33131839-33131861 CCTGAAAAAAAAGAGGTGGAAGG - Intronic
1053004395 9:34594350-34594372 CCAGGAAAACAACTTGAGGAAGG - Intergenic
1053202387 9:36161627-36161649 CCTAGAAACCAAAAGGGGGAGGG + Intronic
1053243145 9:36513189-36513211 TCTGGAAAAAAAAAAGAGGTGGG + Intergenic
1053621994 9:39828851-39828873 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1053837926 9:42160713-42160735 CATGGAAAAAAAAAGATGGAAGG + Intergenic
1054268028 9:62939105-62939127 ACTAGAAAACAAAAGCAGCAGGG - Intergenic
1054694656 9:68348133-68348155 CCTGGAAAATTAAAGGAACAAGG + Intronic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1054784925 9:69201363-69201385 CCTGACAAAGAAAAGGGGGAGGG - Intronic
1055824541 9:80307259-80307281 CCTGAAACACAAAGGAAGGAAGG - Intergenic
1055833851 9:80415974-80415996 CCTGAAAAAAATGAGGAGGAGGG - Intergenic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1057495961 9:95561473-95561495 CCTGGAAATCATAAAGAGGCAGG + Intergenic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1057699257 9:97350839-97350861 CATGGAAACTGAAAGGAGGATGG - Intronic
1058199912 9:102026845-102026867 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1059391435 9:114001974-114001996 CCTGGAAAACAGAAGAGGAAAGG - Exonic
1059479218 9:114575404-114575426 CCAGGAACACAAAAGGATGAGGG + Intergenic
1059776304 9:117478737-117478759 TCAGGAAAGGAAAAGGAGGAGGG - Intergenic
1061138732 9:128751643-128751665 CATTAAAAACAAAAGGAGTAGGG - Intronic
1061668104 9:132172160-132172182 CCTTGAAAAGAAAGGAAGGAGGG - Intronic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1203570820 Un_KI270744v1:128954-128976 CCTGGAAAACGGAAGTAGAAAGG + Intergenic
1185575559 X:1169266-1169288 AGTGGAGAAGAAAAGGAGGAGGG + Intergenic
1186107923 X:6226746-6226768 CTTGGAAAACCAGAGGCGGAGGG + Intronic
1186296609 X:8155578-8155600 ACTGGCAAAGAAAAGGAGGTGGG + Intergenic
1186383460 X:9085587-9085609 CCCAGAAAACAAAAGAAGGGAGG - Intronic
1186503004 X:10066852-10066874 TCTGGAAAATGAAAGGAGAAGGG + Intronic
1186609094 X:11121280-11121302 GCTAGAAAAGAAAGGGAGGATGG - Intronic
1187127113 X:16464013-16464035 CCTGAAAAAAAAAGGAAGGAAGG + Intergenic
1187222841 X:17346304-17346326 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187708615 X:22031484-22031506 CCAGCAAAACAAAAGCAGGTAGG + Intergenic
1187953701 X:24495186-24495208 CAAGGAAAACGAAAGGAGTAAGG - Intronic
1188494713 X:30771588-30771610 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1188778494 X:34251709-34251731 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189261733 X:39684023-39684045 CCTAGAAAAGAAAAGGAAGAGGG - Intergenic
1189366680 X:40394285-40394307 CCTCAAAAAAAAAAGAAGGAAGG + Intergenic
1189382916 X:40514464-40514486 CTTAGAAGAGAAAAGGAGGAAGG + Intergenic
1191707771 X:64112561-64112583 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1191751467 X:64547644-64547666 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1191990382 X:67028485-67028507 AATGGAAAACAAAAAAAGGAAGG + Intergenic
1192274121 X:69612647-69612669 CCAGACAAACAAAAGTAGGAAGG + Intergenic
1192343164 X:70280686-70280708 ACTGGAAAACTAAGGGAGGGAGG + Intronic
1192605028 X:72507454-72507476 CCTGGAAAACAAAAGGTTGGGGG - Intronic
1192838810 X:74832137-74832159 TCTGGAAAAAAAGAGCAGGAGGG - Intronic
1192854781 X:74997855-74997877 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1192879167 X:75264547-75264569 AATGGAAAACAAAAAAAGGAAGG - Intergenic
1192900619 X:75492109-75492131 ACTGGAAAACAAAAAAAGGCAGG + Intronic
1192918820 X:75684211-75684233 AATGGAAAACAAAAAGAGGCAGG - Intergenic
1192939024 X:75893369-75893391 CCTAGAGAACAAAGGAAGGAGGG - Intergenic
1193059213 X:77186769-77186791 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1193299489 X:79872582-79872604 ACTGGAAAAAAAAAGGTGGGGGG + Intergenic
1193653183 X:84164499-84164521 ACTGAAAAACAAAAGGACAAAGG + Intronic
1195092364 X:101473125-101473147 AATGGAAAACAAAAAGAGGCAGG + Intronic
1195147698 X:102033744-102033766 AATGGAAAACAAAAAGAGGCAGG + Intergenic
1195280576 X:103329225-103329247 CATGGAAAACATAAATAGGATGG + Intergenic
1195461042 X:105124594-105124616 CCTGTAATAGAAAATGAGGAGGG - Intronic
1195832070 X:109070448-109070470 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1196361656 X:114868342-114868364 CCTGGAAGCAAAAAGGAGGAGGG - Intronic
1196553030 X:117052975-117052997 CCTGGAAGACACAAGGGAGAGGG + Intergenic
1196849942 X:119927742-119927764 CCTGAAAAAGAAGAGCAGGAAGG - Intronic
1197838822 X:130723715-130723737 CCTGGGAAACAAAATGGGGAGGG - Intronic
1197889038 X:131249376-131249398 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1198273545 X:135079081-135079103 CTAGGGAAAAAAAAGGAGGAGGG - Intergenic
1198418337 X:136444097-136444119 AGTGGAAAACAAAAGAAGGCAGG - Intergenic
1199045711 X:143168889-143168911 CCTGAAAAAGAAAACAAGGACGG + Intergenic
1199465096 X:148127294-148127316 AATGGAAAACAAAAGAAGGCAGG - Intergenic
1200889611 Y:8309518-8309540 ACTGGAAAACAAAAAAAGGCAGG - Intergenic
1202200575 Y:22343441-22343463 AATGGAAAACAAAAAAAGGAAGG - Intronic
1202357414 Y:24066015-24066037 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1202513363 Y:25604099-25604121 CATGGAAAACAAAAAAAGGCAGG - Intergenic