ID: 996817088

View in Genome Browser
Species Human (GRCh38)
Location 5:127586441-127586463
Sequence GATGCTGGAGTCCCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996817088_996817091 2 Left 996817088 5:127586441-127586463 CCAGATTGTGGGACTCCAGCATC No data
Right 996817091 5:127586466-127586488 CACTGTTAATCAGTAACAAGAGG No data
996817088_996817092 27 Left 996817088 5:127586441-127586463 CCAGATTGTGGGACTCCAGCATC No data
Right 996817092 5:127586491-127586513 GCCTGAGCAAATGCAAAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996817088 Original CRISPR GATGCTGGAGTCCCACAATC TGG (reversed) Intergenic
No off target data available for this crispr