ID: 996818737

View in Genome Browser
Species Human (GRCh38)
Location 5:127602157-127602179
Sequence ATGAGCCAAGCAACGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996818737_996818745 -8 Left 996818737 5:127602157-127602179 CCTCCATCCGTTGCTTGGCTCAT No data
Right 996818745 5:127602172-127602194 TGGCTCATGGCTCTTCTGGGGGG No data
996818737_996818746 19 Left 996818737 5:127602157-127602179 CCTCCATCCGTTGCTTGGCTCAT No data
Right 996818746 5:127602199-127602221 ATAAGAACACATGATATCTATGG No data
996818737_996818744 -9 Left 996818737 5:127602157-127602179 CCTCCATCCGTTGCTTGGCTCAT No data
Right 996818744 5:127602171-127602193 TTGGCTCATGGCTCTTCTGGGGG No data
996818737_996818743 -10 Left 996818737 5:127602157-127602179 CCTCCATCCGTTGCTTGGCTCAT No data
Right 996818743 5:127602170-127602192 CTTGGCTCATGGCTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996818737 Original CRISPR ATGAGCCAAGCAACGGATGG AGG (reversed) Intergenic