ID: 996819588

View in Genome Browser
Species Human (GRCh38)
Location 5:127611804-127611826
Sequence TATGGCCAACCCAGAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819588_996819594 24 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819594 5:127611851-127611873 GTCCTAGTGGAGATGTGAAGGGG No data
996819588_996819593 23 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819593 5:127611850-127611872 TGTCCTAGTGGAGATGTGAAGGG No data
996819588_996819592 22 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG No data
996819588_996819590 11 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819590 5:127611838-127611860 ATAACCTTTAAATGTCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819588 Original CRISPR TATGGCCAACCCAGAATTCC TGG (reversed) Intergenic
No off target data available for this crispr