ID: 996819589

View in Genome Browser
Species Human (GRCh38)
Location 5:127611822-127611844
Sequence AGGTTATTGCAGATTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819589_996819593 5 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819593 5:127611850-127611872 TGTCCTAGTGGAGATGTGAAGGG No data
996819589_996819592 4 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG No data
996819589_996819596 13 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819596 5:127611858-127611880 TGGAGATGTGAAGGGGCACGTGG No data
996819589_996819594 6 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819594 5:127611851-127611873 GTCCTAGTGGAGATGTGAAGGGG No data
996819589_996819590 -7 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819590 5:127611838-127611860 ATAACCTTTAAATGTCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819589 Original CRISPR AGGTTATTGCAGATTGAATA TGG (reversed) Intergenic
No off target data available for this crispr