ID: 996819591

View in Genome Browser
Species Human (GRCh38)
Location 5:127611842-127611864
Sequence ATCTCCACTAGGACATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819591_996819601 23 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819601 5:127611888-127611910 CGTAGATTTAGGGGAAAGGCAGG No data
996819591_996819596 -7 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819596 5:127611858-127611880 TGGAGATGTGAAGGGGCACGTGG No data
996819591_996819600 19 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819600 5:127611884-127611906 TAAGCGTAGATTTAGGGGAAAGG No data
996819591_996819598 13 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819598 5:127611878-127611900 TGGCTATAAGCGTAGATTTAGGG No data
996819591_996819597 12 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819597 5:127611877-127611899 GTGGCTATAAGCGTAGATTTAGG No data
996819591_996819599 14 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819599 5:127611879-127611901 GGCTATAAGCGTAGATTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819591 Original CRISPR ATCTCCACTAGGACATTTAA AGG (reversed) Intergenic
No off target data available for this crispr