ID: 996819592

View in Genome Browser
Species Human (GRCh38)
Location 5:127611849-127611871
Sequence ATGTCCTAGTGGAGATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819589_996819592 4 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG No data
996819588_996819592 22 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819592 Original CRISPR ATGTCCTAGTGGAGATGTGA AGG Intergenic
No off target data available for this crispr