ID: 996819594

View in Genome Browser
Species Human (GRCh38)
Location 5:127611851-127611873
Sequence GTCCTAGTGGAGATGTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819588_996819594 24 Left 996819588 5:127611804-127611826 CCAGGAATTCTGGGTTGGCCATA No data
Right 996819594 5:127611851-127611873 GTCCTAGTGGAGATGTGAAGGGG No data
996819589_996819594 6 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819594 5:127611851-127611873 GTCCTAGTGGAGATGTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819594 Original CRISPR GTCCTAGTGGAGATGTGAAG GGG Intergenic
No off target data available for this crispr