ID: 996819596

View in Genome Browser
Species Human (GRCh38)
Location 5:127611858-127611880
Sequence TGGAGATGTGAAGGGGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996819591_996819596 -7 Left 996819591 5:127611842-127611864 CCTTTAAATGTCCTAGTGGAGAT No data
Right 996819596 5:127611858-127611880 TGGAGATGTGAAGGGGCACGTGG No data
996819589_996819596 13 Left 996819589 5:127611822-127611844 CCATATTCAATCTGCAATAACCT No data
Right 996819596 5:127611858-127611880 TGGAGATGTGAAGGGGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996819596 Original CRISPR TGGAGATGTGAAGGGGCACG TGG Intergenic
No off target data available for this crispr