ID: 996820360

View in Genome Browser
Species Human (GRCh38)
Location 5:127619778-127619800
Sequence GAGCCAGTCCTTCCTAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996820354_996820360 13 Left 996820354 5:127619742-127619764 CCCAAAGGTGTCAGACTCTTAGT No data
Right 996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG No data
996820353_996820360 14 Left 996820353 5:127619741-127619763 CCCCAAAGGTGTCAGACTCTTAG No data
Right 996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG No data
996820352_996820360 15 Left 996820352 5:127619740-127619762 CCCCCAAAGGTGTCAGACTCTTA No data
Right 996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG No data
996820355_996820360 12 Left 996820355 5:127619743-127619765 CCAAAGGTGTCAGACTCTTAGTC No data
Right 996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG No data
996820351_996820360 16 Left 996820351 5:127619739-127619761 CCCCCCAAAGGTGTCAGACTCTT No data
Right 996820360 5:127619778-127619800 GAGCCAGTCCTTCCTAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996820360 Original CRISPR GAGCCAGTCCTTCCTAGATC AGG Intergenic
No off target data available for this crispr