ID: 996820423

View in Genome Browser
Species Human (GRCh38)
Location 5:127620334-127620356
Sequence TGACATCTGAAAATAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996820421_996820423 20 Left 996820421 5:127620291-127620313 CCAACTTCTATGACCAAGAGAAT No data
Right 996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG No data
996820422_996820423 7 Left 996820422 5:127620304-127620326 CCAAGAGAATATGATAGAAGTGA No data
Right 996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996820423 Original CRISPR TGACATCTGAAAATAGATCA TGG Intergenic
No off target data available for this crispr