ID: 996825560

View in Genome Browser
Species Human (GRCh38)
Location 5:127677806-127677828
Sequence AATTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825560_996825564 15 Left 996825560 5:127677806-127677828 CCTGCCATCTTCTGCAGATAATT No data
Right 996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG No data
996825560_996825565 22 Left 996825560 5:127677806-127677828 CCTGCCATCTTCTGCAGATAATT No data
Right 996825565 5:127677851-127677873 CTTGGCCTGTTATTGGACTTCGG No data
996825560_996825562 4 Left 996825560 5:127677806-127677828 CCTGCCATCTTCTGCAGATAATT No data
Right 996825562 5:127677833-127677855 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
996825560_996825566 25 Left 996825560 5:127677806-127677828 CCTGCCATCTTCTGCAGATAATT No data
Right 996825566 5:127677854-127677876 GGCCTGTTATTGGACTTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996825560 Original CRISPR AATTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr