ID: 996825564

View in Genome Browser
Species Human (GRCh38)
Location 5:127677844-127677866
Sequence GACAGCTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825560_996825564 15 Left 996825560 5:127677806-127677828 CCTGCCATCTTCTGCAGATAATT No data
Right 996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG No data
996825559_996825564 16 Left 996825559 5:127677805-127677827 CCCTGCCATCTTCTGCAGATAAT No data
Right 996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG No data
996825561_996825564 11 Left 996825561 5:127677810-127677832 CCATCTTCTGCAGATAATTACTC No data
Right 996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996825564 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr