ID: 996825669

View in Genome Browser
Species Human (GRCh38)
Location 5:127678619-127678641
Sequence TCAGTGATGACAGGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825669_996825679 7 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825679 5:127678649-127678671 CATGAACAAAGTCGCCATGGTGG No data
996825669_996825682 16 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825682 5:127678658-127678680 AGTCGCCATGGTGGCAGGGATGG No data
996825669_996825676 4 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825676 5:127678646-127678668 GCCCATGAACAAAGTCGCCATGG No data
996825669_996825684 29 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825669_996825685 30 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825669_996825680 11 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825669_996825681 12 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825681 5:127678654-127678676 ACAAAGTCGCCATGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996825669 Original CRISPR TCAGTGATGACAGGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr