ID: 996825680

View in Genome Browser
Species Human (GRCh38)
Location 5:127678653-127678675
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825673_996825680 4 Left 996825673 5:127678626-127678648 CCCCTGTCATCACTGAATGGGCC No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825666_996825680 20 Left 996825666 5:127678610-127678632 CCTCTTTCCCCAGCCACCCCTGT 0: 114
1: 198
2: 154
3: 227
4: 1166
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825667_996825680 13 Left 996825667 5:127678617-127678639 CCCCAGCCACCCCTGTCATCACT No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825674_996825680 3 Left 996825674 5:127678627-127678649 CCCTGTCATCACTGAATGGGCCC No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825668_996825680 12 Left 996825668 5:127678618-127678640 CCCAGCCACCCCTGTCATCACTG No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825675_996825680 2 Left 996825675 5:127678628-127678650 CCTGTCATCACTGAATGGGCCCA No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825665_996825680 28 Left 996825665 5:127678602-127678624 CCACTCAGCCTCTTTCCCCAGCC 0: 154
1: 207
2: 160
3: 170
4: 826
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825669_996825680 11 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data
996825670_996825680 7 Left 996825670 5:127678623-127678645 CCACCCCTGTCATCACTGAATGG No data
Right 996825680 5:127678653-127678675 AACAAAGTCGCCATGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr