ID: 996825684

View in Genome Browser
Species Human (GRCh38)
Location 5:127678671-127678693
Sequence GCAGGGATGGAAGTTATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 10, 1: 105, 2: 205, 3: 252, 4: 404}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825670_996825684 25 Left 996825670 5:127678623-127678645 CCACCCCTGTCATCACTGAATGG No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825668_996825684 30 Left 996825668 5:127678618-127678640 CCCAGCCACCCCTGTCATCACTG No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825673_996825684 22 Left 996825673 5:127678626-127678648 CCCCTGTCATCACTGAATGGGCC No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825669_996825684 29 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825675_996825684 20 Left 996825675 5:127678628-127678650 CCTGTCATCACTGAATGGGCCCA No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825677_996825684 1 Left 996825677 5:127678647-127678669 CCCATGAACAAAGTCGCCATGGT No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825674_996825684 21 Left 996825674 5:127678627-127678649 CCCTGTCATCACTGAATGGGCCC No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404
996825678_996825684 0 Left 996825678 5:127678648-127678670 CCATGAACAAAGTCGCCATGGTG No data
Right 996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG 0: 10
1: 105
2: 205
3: 252
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996825684 Original CRISPR GCAGGGATGGAAGTTATGCA TGG Intergenic
900644721 1:3703735-3703757 GCAGGGATGGGAGTCGGGCAGGG + Intronic
901444819 1:9301693-9301715 GCAGAGATGGAGGTGATGCATGG + Intronic
901903795 1:12390805-12390827 GCAGGGATGGAGGTTATGCATGG - Intronic
903939726 1:26921464-26921486 GCAGGGTTGGAAGTTAAAAAGGG - Intronic
904040337 1:27580574-27580596 TCAGGGTTGGAAGTTAAGCCTGG - Intronic
904269058 1:29337221-29337243 GCAGGGATGGAAGATATGCCTGG + Intergenic
904454590 1:30639824-30639846 GCAGGGCTGGAAGTAATCCTCGG + Intergenic
904689250 1:32281607-32281629 ACAGGGATGGAATTTTTGAAAGG + Intronic
904829403 1:33296967-33296989 GCAGGGAAGGTATTTTTGCAAGG + Intronic
905354198 1:37369653-37369675 GCAGGGATGGAGGTTACACATGG + Intergenic
905465353 1:38148974-38148996 GCAGGGATGGAGGTTATTCATGG + Intergenic
906187604 1:43872802-43872824 GCAGGAATGGAAGTTAGAGAGGG + Intronic
906258922 1:44371487-44371509 GGATGGAAGGAAGTTATGCATGG + Intergenic
906266797 1:44437477-44437499 ACAGGGTTGTAAGTTATGCGGGG - Intronic
906414000 1:45605134-45605156 GTAGTGATGGAAGTTGTGAATGG + Intronic
906750174 1:48251801-48251823 GAAGGGAAGGGAGCTATGCAGGG - Intergenic
906867877 1:49441893-49441915 GCAGGGATGGAGGTTACGCATGG + Intronic
906879781 1:49577325-49577347 GCAAGGATGGAGGTTACACATGG + Intronic
906996004 1:50795091-50795113 ACAGAGATGGAGGTTAAGCATGG + Intronic
907597474 1:55732991-55733013 GTAGGGATGGAGGTTATGCATGG + Intergenic
907780464 1:57561706-57561728 GCTGGGATGGAGGTTACGCATGG + Intronic
908052435 1:60247582-60247604 GCAGGAATGGAGGTTATGCATGG + Intergenic
908737511 1:67291684-67291706 GCAGGGATGGAGGTTTCGCATGG + Intergenic
909172480 1:72314594-72314616 GCAGGGATGGAGGTTATGCATGG - Intergenic
909278839 1:73722972-73722994 GCAAGAATGGAGGTTATGCATGG + Intergenic
909548828 1:76876327-76876349 GCAGGGATGGAGGTTACACATGG - Intronic
909811068 1:79932201-79932223 GCAGGGATGAAGGTTATGCATGG + Intergenic
910010280 1:82452896-82452918 GCAGAGATGGAGGTTATGTATGG + Intergenic
910141655 1:84032897-84032919 GCACAGATGGAGGTCATGCATGG + Intergenic
910349667 1:86281107-86281129 GCAGGGATGGAGGTTGTGTTTGG + Intergenic
910370761 1:86513002-86513024 GCAGGGATGGAGGTTACTCATGG + Intergenic
910562017 1:88600840-88600862 GCAGGGATGGAAGTTAGACACGG + Intergenic
910565437 1:88637987-88638009 GCAGGGATGGAGCGTATGCATGG - Intergenic
910565570 1:88639195-88639217 GCAAGGATGGAGGGTATGCATGG - Intergenic
910588342 1:88902591-88902613 GCAGGAATGGAGGTTACGGATGG + Intergenic
910623067 1:89276977-89276999 GCAGGGATGAAATCTTTGCATGG - Intergenic
910630338 1:89347135-89347157 TCAGGGGTGGAAGTTATGCATGG + Intergenic
910638862 1:89439103-89439125 GCAGGGATGGAGGTTACGCATGG - Intergenic
910790455 1:91044614-91044636 GCAGGGATGGAGATTATACATGG + Intergenic
910830975 1:91462550-91462572 GCAGGGATGGAGGTTACACATGG - Intergenic
910948335 1:92617579-92617601 GCAGGGATGGAAGTTACACATGG + Intronic
911109046 1:94163833-94163855 GCAGGGATGGAGGTTACGCATGG - Intronic
911221484 1:95252057-95252079 GCAGGGACGGAGGTTATTCATGG - Intergenic
911738272 1:101361060-101361082 GCAGGGATGGAGATTACACATGG - Intergenic
911883694 1:103271333-103271355 GCAGGGATGGAAGTTATGCATGG + Intergenic
911980542 1:104560294-104560316 GCAGGGATGGAGGTTATGCATGG + Intergenic
911981747 1:104578082-104578104 GCAGGGATGAAAGTTACACATGG - Intergenic
912050576 1:105524079-105524101 GCAGGGATGGAGGTTATGCATGG - Intergenic
912129789 1:106587186-106587208 GCAGGGATGGAGGTTACGCATGG - Intergenic
912212372 1:107569727-107569749 GCAGGGTTGGAGGTTACACATGG + Intergenic
912251900 1:108020516-108020538 GGAGGGATGGAGGTTACGCATGG - Intergenic
912405764 1:109436302-109436324 GCAGGGATAGAGGCTATGTATGG + Intergenic
912708115 1:111929821-111929843 GGAGGGATGGCAGTTATGAACGG + Intronic
912729717 1:112091525-112091547 GCAGGGAAGGAAGGTTTGGAGGG - Intergenic
912733204 1:112127962-112127984 ACGGGGATGGAGGTTATGCATGG - Intergenic
912943684 1:114067335-114067357 ACAGGGATGGAGGTTACACATGG - Intergenic
914864079 1:151411174-151411196 GAGGGGTTGGAAGTTAGGCAGGG - Intronic
915210490 1:154305191-154305213 GTAGAGATGGAGGTGATGCATGG - Intergenic
915529739 1:156496463-156496485 GCAGGGATGGAAGTCAGCCAAGG + Intronic
915667556 1:157458802-157458824 GCAGGGATGGAGGTCATGCATGG - Intergenic
916106072 1:161433427-161433449 GCAGGGATGGAGGTTACACATGG - Intergenic
916285453 1:163100391-163100413 GCAGGAATGGAGGTTATGCAGGG + Intergenic
916381001 1:164210416-164210438 GCAAGAATGGAAGTCATTCATGG + Intergenic
916635127 1:166660044-166660066 GGAAGGATGGAGATTATGCATGG + Intergenic
917052390 1:170938939-170938961 TCAGGGATGTAAATTATGTATGG - Intronic
917217095 1:172690036-172690058 GCAGGGATGGAAGTTACGCATGG - Intergenic
917247880 1:173024257-173024279 GCAGGGATGAAGGTTATGCATGG - Intergenic
917276602 1:173338029-173338051 GCAGGGATGGAAGTTATGCATGG + Intergenic
917673023 1:177291979-177292001 GCAAGGATGGAGGCTATGAATGG - Intergenic
917764660 1:178202882-178202904 GCAGGGGTGGAGGTTATGCATGG + Intronic
918014768 1:180622789-180622811 ACAGAGATGGAAGATATGCAGGG - Intergenic
918755587 1:188336942-188336964 GCAGGGATGGAGGTTATGCATGG - Intergenic
918774620 1:188611618-188611640 GCAGGGATGGAGGTTACCCATGG + Intergenic
918783349 1:188731696-188731718 GCAGGGATGAAAGTTACACATGG - Intergenic
918815180 1:189172093-189172115 GCAGGGATGGAGATTACACATGG + Intergenic
919000611 1:191827005-191827027 GCAGAGATGGAGGTTACACATGG - Intergenic
919241887 1:194925076-194925098 GCAGTGATGGAGGTTATGCATGG + Intergenic
919330325 1:196162798-196162820 GCAGGGATGGAGGTTACGCATGG + Intergenic
920197557 1:204239227-204239249 GCAGGGATGGGGGTTACACATGG + Intronic
921619908 1:217313982-217314004 GCAGGAATGGAAATTATATATGG + Intergenic
921720911 1:218470002-218470024 GAAAGGGTAGAAGTTATGCATGG + Intergenic
921911384 1:220552962-220552984 GCAGGGATGAAGGTTATGCATGG - Intronic
922082038 1:222306736-222306758 ACAGGGAAGTAAGTTAAGCAAGG - Intergenic
922683195 1:227617959-227617981 TCTGGGAAGGAGGTTATGCATGG + Intronic
922902046 1:229144752-229144774 GCAAGGATGGAGGCTATGGAGGG + Intergenic
923001590 1:230010478-230010500 GCAGTTATGTAAGTTATGTATGG - Intergenic
923683400 1:236137510-236137532 GCAGAGATGGCAGTTATTCTAGG + Intergenic
923916502 1:238511716-238511738 GCAGGGTTGGAAGTTACGGATGG + Intergenic
923926076 1:238628947-238628969 ACAGGGATGGAGGATTTGCATGG - Intergenic
924824887 1:247529013-247529035 GCAGGGATGGAAACTATGAATGG + Intronic
924840649 1:247706959-247706981 GCAGGGATGGAGGTTACACATGG - Intergenic
924847020 1:247784273-247784295 GCAGGGATGAAAGTTATGCATGG - Intergenic
924880783 1:248159871-248159893 GCATGGATGAAAGCTATGCCTGG - Intergenic
1063105422 10:2987875-2987897 ACAGGGAGGGAAGTTCTGCTGGG - Intergenic
1063788242 10:9409376-9409398 GCAGGGATGGAGGTTATGCATGG + Intergenic
1064517461 10:16166931-16166953 GCAGGGATGGAGGTTACATATGG - Intergenic
1064519310 10:16184998-16185020 GCAGGGACAGAGGTTATGTAAGG - Intergenic
1065661210 10:28005749-28005771 ACAGGGATGGAGGCTATGCATGG + Intergenic
1066003707 10:31128211-31128233 GCAGGTATGGAAGCTATGCATGG - Intergenic
1066166901 10:32798357-32798379 GCAGGGATGGAGGTTACGCATGG - Intronic
1066169559 10:32827192-32827214 GCAGGGATGGAGGTTATACATGG + Intronic
1066957742 10:42188924-42188946 TCAGGGATGGAGGCTATGCATGG + Intergenic
1067333266 10:45341090-45341112 GCAGGGATGGAGGTTATACATGG + Intergenic
1067754229 10:48992847-48992869 GCCAGGATGGAGGTTATGCATGG - Intergenic
1068007547 10:51408709-51408731 GCGGGGATGGAGGTTACACACGG - Intronic
1068455872 10:57253026-57253048 GCAGGGATAGAATTTGTGGAGGG - Intergenic
1068837091 10:61567510-61567532 GCAGGGAGGGAGGTTATGCCTGG - Intergenic
1069145876 10:64891297-64891319 GCAGGGATGGAGGTTCCACATGG + Intergenic
1069192184 10:65505499-65505521 GCAGGGATGGAGGTTACACATGG - Intergenic
1069209804 10:65741987-65742009 GCAGGGATGGAGGTTATGCATGG - Intergenic
1069790707 10:71018713-71018735 ACAGGGATGGAGGTTATGCATGG - Intergenic
1071032863 10:81205586-81205608 GCAGGGACAGACGTTATGCATGG + Intergenic
1071266954 10:83973133-83973155 GCAGGGATGGAGGTTACACATGG - Intergenic
1071308633 10:84322923-84322945 ACAGGGATGGAGGTTATGAATGG + Intergenic
1071378501 10:85034230-85034252 GCAGGGATGAAGGTTATGCATGG + Intergenic
1071673793 10:87636555-87636577 CAATGGATGGAGGTTATGCATGG - Intergenic
1071920134 10:90340465-90340487 GCAGGGATGGTAGCTCTTCATGG + Intergenic
1071937813 10:90550149-90550171 GCGGGGATGGAGGTTATCCATGG + Intergenic
1071942661 10:90606903-90606925 GCAGGGATGGAGGTTATGCCTGG - Intergenic
1071950706 10:90700205-90700227 GCTGGGAAGGAGGTTATACATGG - Intergenic
1072361963 10:94668397-94668419 GCAGGGACAGAGGTTATGCACGG - Intergenic
1072671776 10:97435404-97435426 GAAGGGATGAGAGTTAAGCATGG - Intergenic
1073247590 10:102102500-102102522 GCAAGGAGGGAAGTAATCCAGGG + Intergenic
1073656558 10:105423621-105423643 GCAGGGATGGAGGTTATCCATGG - Intergenic
1073830402 10:107377137-107377159 GCAGGGATGAAGGTAATGCATGG - Intergenic
1073995752 10:109313865-109313887 GCAGGGATGGAGGTTATTCTTGG - Intergenic
1074235542 10:111581240-111581262 GCATAGATGGAGGTTATACATGG - Intergenic
1074632408 10:115273199-115273221 GCAGGGATGGAGATTATGCATGG - Intronic
1075606914 10:123818276-123818298 GCAGGGATGGAGGTTACGCATGG + Intronic
1076123404 10:127954187-127954209 GCAGGGATGGAGGCTGTTCATGG + Intronic
1076271440 10:129155693-129155715 GCAGGGATGGAAGCTATGCATGG + Intergenic
1076393954 10:130124928-130124950 GCAGGCAAGGAGCTTATGCAGGG - Intergenic
1076522603 10:131090445-131090467 GCAGGGATGCAGGGTCTGCATGG - Intergenic
1076646204 10:131956582-131956604 GCATAGAATGAAGTTATGCAGGG + Intronic
1076927280 10:133498345-133498367 GCAGGGATGGAGGTTATGAATGG - Intergenic
1077389711 11:2294597-2294619 GCAGGGATGGAGGTCACACATGG - Intergenic
1077401374 11:2359633-2359655 GCAGGGATGGAGGTTGTGCGTGG + Intergenic
1077557656 11:3233547-3233569 GAAGGCATGGAACTTATGAAAGG - Intergenic
1079192744 11:18294544-18294566 GGAAGGAGGGGAGTTATGCAGGG + Intronic
1079797823 11:24828531-24828553 ACAGGGATGGTAGCTGTGCAAGG - Intronic
1080076718 11:28158362-28158384 GCAGGGATGGAGTTTATGCATGG + Intronic
1080115060 11:28612649-28612671 GCAGGGATAGAGGCTATGCATGG - Intergenic
1081110647 11:39129582-39129604 GCAGGGATGGAGGTTATGCATGG + Intergenic
1081142872 11:39524611-39524633 CCAGGGAGGGAAATTATGCCTGG - Intergenic
1081378407 11:42386774-42386796 GCAGAGATGGAGGTTACGCGTGG + Intergenic
1081402211 11:42656422-42656444 GCAGAGATGGAGGCTATGCAGGG - Intergenic
1081520353 11:43875549-43875571 GCAGGGATGGAGGATATGCATGG - Intergenic
1081609184 11:44548725-44548747 GCAGGGCTGGAGGTTACGCATGG + Intergenic
1081762581 11:45586845-45586867 TCAGGGAAGGAAGCTATGCCAGG + Intergenic
1082671812 11:56043889-56043911 GCAGGGATGGAGGTTACACATGG + Intergenic
1082920347 11:58485771-58485793 GCAGGGATGGAGGATATGCATGG + Intergenic
1082999781 11:59280710-59280732 GTAGGGATGGAGGTTACCCATGG + Intergenic
1083093259 11:60221973-60221995 GCAGGGATGGAGGATATGCATGG + Intronic
1083689926 11:64401308-64401330 GCAGAGATGGAGGTTATGCAGGG + Intergenic
1083744138 11:64725963-64725985 GCAGGGATGGATGTGATGTGGGG + Intergenic
1084453362 11:69252862-69252884 GCAGGGAAGGAGGTGATGGAAGG + Intergenic
1085243377 11:75076894-75076916 ACAAGGAAGGAAGTTGTGCATGG - Intergenic
1085616102 11:78000159-78000181 GCAGGGATAGAGGCTATTCATGG - Intergenic
1085684787 11:78611713-78611735 GCAGGGATGGAGGTTATGCACGG + Intergenic
1085686078 11:78623033-78623055 GCAGGGATGGAGATTACGCATGG + Intergenic
1086141511 11:83505356-83505378 GCAGGGATGGAGATTATGCATGG - Intronic
1086278728 11:85161295-85161317 GTAGGGTTGGAGGTTATACATGG + Intronic
1086399834 11:86451490-86451512 GTAAGGATGGAGGCTATGCATGG + Intronic
1086834243 11:91601231-91601253 GCAGGCATGGAGGTTACACATGG + Intergenic
1086944238 11:92829283-92829305 GCAGGCATGAAATTCATGCAGGG - Intronic
1087526620 11:99321854-99321876 GCAGAGATGGAGGTTATGCATGG - Intronic
1087815467 11:102653560-102653582 TCAGGTATGGTAGATATGCAAGG - Intergenic
1088097335 11:106116001-106116023 GCAGGGATGGACGTTACACATGG + Intergenic
1088191531 11:107233649-107233671 GCAGAGATGGAGGTTACACATGG - Intergenic
1088265543 11:107984447-107984469 GCAGGCATGGAGGTTATGCATGG + Intergenic
1088407493 11:109497818-109497840 GCAGAGATGGAGGTTACACATGG - Intergenic
1088449470 11:109966199-109966221 GCAGGGACAGAGGTTATGCATGG + Intergenic
1088469572 11:110178136-110178158 GCAGAGATGGAGGTTATCCCTGG - Intronic
1088836781 11:113584227-113584249 GCAGGGATGGAGGTTACGCATGG + Intergenic
1089806431 11:121094679-121094701 GCAGGGTTGGAGGTTATGCATGG - Intergenic
1089903737 11:122014459-122014481 GCAGGGATGAAAGTTACACATGG + Intergenic
1090119074 11:124005548-124005570 GCAGGGATGGAGGTTACGAATGG - Intergenic
1090209368 11:124907210-124907232 GCAGGGATGGAGGTTACGCATGG - Intergenic
1090221487 11:125030755-125030777 GCAGGGATGGAGGTTACGCATGG - Intronic
1090575232 11:128095046-128095068 GCAAGGATGGAAGTTACGCATGG + Intergenic
1090753891 11:129771777-129771799 GCAGTGATGGAGGTTATGCTTGG - Intergenic
1091103588 11:132898062-132898084 GTAGGGATGGAGGTTGTGCACGG + Intronic
1091672885 12:2465847-2465869 TCTGGGATGGAGGTCATGCAGGG - Intronic
1092093404 12:5822481-5822503 GCAGGGATGGAGGTTACACATGG + Intronic
1092272517 12:7034538-7034560 GCCAGGATGGACATTATGCATGG + Intronic
1092381669 12:8001770-8001792 GCAGGGATGGAGATTACGCATGG + Intergenic
1092727877 12:11501765-11501787 GAAGGGGTGGAAGTGTTGCAAGG + Intergenic
1093031743 12:14295088-14295110 GCAGGGATGGAGGTTATACATGG - Intergenic
1093036466 12:14336522-14336544 GCAGGGATGGAGGTTGCACATGG + Intergenic
1093036827 12:14339836-14339858 GCAGGGATGGAGGATATTCATGG + Intergenic
1093048818 12:14484229-14484251 GCAGTGATGGAGGTGATGCCTGG - Intronic
1093274566 12:17108278-17108300 ATAGGAATGGAAGTTTTGCAAGG + Intergenic
1093349394 12:18079422-18079444 GCAGAGATGGAAGCAATGCATGG + Intergenic
1093645836 12:21584517-21584539 GCAGGGATGGAAGTTATGCTTGG + Intronic
1093698605 12:22191860-22191882 ACAGGCATGGAGGTTATGCATGG + Intronic
1093964661 12:25311798-25311820 GCAGGGATGGAGGTTACACATGG + Intergenic
1093981487 12:25479951-25479973 GCAGGGATGGAGGTTATGCATGG - Intronic
1094102653 12:26780109-26780131 GCAGGGATAGAGGTTACTCATGG + Intronic
1094207186 12:27853020-27853042 GCAGGGATGAAGGGTATGGACGG - Intergenic
1094389670 12:29935376-29935398 CCAGGGATGGAGGATACGCATGG - Intergenic
1095121389 12:38423992-38424014 GCAGGGATGGAGGTTATGCATGG - Intergenic
1095190373 12:39251008-39251030 GCAGGGATGATGGTTATGCATGG + Intergenic
1095503083 12:42861953-42861975 GCAGGGAGGGAAGTTTTCCAGGG - Intergenic
1095603974 12:44045182-44045204 GCAGGGATGGAGGTTACACATGG + Intronic
1095738624 12:45584973-45584995 GCAGGGATGGGGGTTACACATGG + Intergenic
1095775283 12:46003518-46003540 GCAGAGATGGAGGTTATACATGG - Intergenic
1095844266 12:46729127-46729149 GCAGGAGTGGAGGTTAGGCATGG - Intergenic
1095856132 12:46862829-46862851 GCAGGGATGGAGCTTACACATGG - Intergenic
1096288894 12:50324097-50324119 GCAGGACTGGAGGTTATGCGTGG + Intergenic
1096457339 12:51798601-51798623 GCAGGGATGGAGGTTACGCATGG - Intronic
1096735091 12:53646973-53646995 GCAGGAATGGAACTTATGCATGG + Intronic
1097077119 12:56403246-56403268 GCAGGGATGGAGGTTACACATGG + Intergenic
1097313839 12:58151270-58151292 GCAGGGATGGAGGTTATGTGTGG - Intergenic
1097437710 12:59571409-59571431 GTGGGGGTGGAAGTTATGCATGG - Intergenic
1097554711 12:61122449-61122471 GCAGAGATGGAGGTTACACATGG + Intergenic
1097564528 12:61251601-61251623 GTGGGGGTGGAAGTTATGCATGG - Intergenic
1097821229 12:64131061-64131083 GCAGGGATGGAGGTTACTCATGG - Intronic
1097843226 12:64341905-64341927 GCAGGGATGGAGGTTATGCATGG - Intronic
1098031376 12:66258187-66258209 ACAGGGATGAAAGTTATGTGTGG - Intergenic
1098239350 12:68450686-68450708 GAAGGGATGGAAGATATACAAGG + Intergenic
1098589297 12:72190773-72190795 GCAGGGATGAAAGTAATGCATGG + Intronic
1098714497 12:73812752-73812774 ACACAGATGGAGGTTATGCATGG + Intergenic
1098716220 12:73830651-73830673 GCAGGGATGGAGGCTACACAAGG + Intergenic
1098731174 12:74038183-74038205 GCAGGGATGGAGGTTACACATGG + Intergenic
1098733413 12:74066478-74066500 GCAGGGATGGAGGTTATGGATGG + Intergenic
1098745796 12:74235430-74235452 GCAGGGATGGAAGCTAAGCAGGG + Intergenic
1098831790 12:75373185-75373207 GCAGGGATGAAGGTTACACATGG - Intronic
1098937908 12:76501643-76501665 ACAGGGATGGAGGTTATGCATGG + Intronic
1099147220 12:79061727-79061749 GCATGGAAGGAAGTCATGTAAGG - Intronic
1099366051 12:81766227-81766249 GTAGGGATGGAGGTTATGCATGG + Intergenic
1099375768 12:81894796-81894818 GCAGGGATGGAGGTTATGCATGG + Intergenic
1099379269 12:81935705-81935727 GCAGGGATGGAGGTTATGCATGG - Intergenic
1099401088 12:82204520-82204542 GCAGGCATGAAGGTTATGCATGG - Intergenic
1099490555 12:83283405-83283427 GCAGGGATGGACGTTACTTATGG - Intergenic
1099508689 12:83508031-83508053 GCAGGGATGGAGGTTATGGATGG + Intergenic
1099526481 12:83723940-83723962 GCAAGGATGGAGCTTATGCATGG + Intergenic
1099578185 12:84406246-84406268 GCAGGGATGGAGGCTATGCATGG + Intergenic
1099700767 12:86078703-86078725 GCAGGGATAGAGGTTATGCATGG - Intronic
1099804329 12:87498777-87498799 GCAGCGATGGAAGTTATACATGG - Intergenic
1099813630 12:87618418-87618440 GTAGTGATGCAAGTTATGCATGG - Intergenic
1100083424 12:90879053-90879075 GCAGGGATGGAGGTTATGCATGG + Intergenic
1100126325 12:91430840-91430862 GCAGGGGTAGAAGAAATGCAGGG - Intergenic
1100232074 12:92618756-92618778 GCAGGGATGGAGGTTACACATGG + Intergenic
1100956762 12:99917390-99917412 TCAGGGATGGAGGCTATGCATGG + Intronic
1101264260 12:103066963-103066985 GCAGGGATGGAGGTTTCACATGG + Intergenic
1101534541 12:105605259-105605281 GCAGGGTTGGAGGTTACACATGG - Intergenic
1101543189 12:105683482-105683504 GTAGGGATGGAGGTTACACATGG + Intergenic
1101697247 12:107138386-107138408 GCAGGGATGGAAGTTATGCATGG - Intergenic
1101852533 12:108415601-108415623 GCAGAGATGGAGATGATGCATGG - Intergenic
1102551948 12:113697780-113697802 GCAGGCAGAGAAGCTATGCAAGG - Intergenic
1102895626 12:116595871-116595893 GAAGGGATGGAAGGGATGGATGG + Intergenic
1103396656 12:120612295-120612317 GCAGGAATGGAGGTTATGCATGG + Intergenic
1104147917 12:126053509-126053531 GCAGGGATGGAGGTTATGTATGG + Intergenic
1105728319 13:23187105-23187127 GCAGGGAGGGAGGCCATGCATGG - Intronic
1106046162 13:26144194-26144216 GCAGGGATGGAGGTTATGCATGG - Intronic
1106054687 13:26227385-26227407 GCAGAGGTGGAGGCTATGCATGG - Intergenic
1106161156 13:27202484-27202506 GCAGGGATGGACGCTATGCATGG + Intergenic
1106770832 13:32959173-32959195 GCAGGGATGGAGGTCAGGCACGG - Intergenic
1107505279 13:41027418-41027440 GCAGGGATGGAGGTTATTCACGG + Intronic
1107983458 13:45755115-45755137 GCAGAGATGGAGGTTATGCATGG - Intergenic
1108166929 13:47702867-47702889 GCAAGAATGGAGGTTATGCATGG + Intergenic
1108531062 13:51327876-51327898 GCAGGGCTGGAAGTTACTCTGGG - Intergenic
1109069566 13:57747444-57747466 GCACTGATGGAGGTTATGCAGGG + Intergenic
1109335980 13:60994291-60994313 GCTGGGATGGAAGATATGTAGGG - Intergenic
1109583161 13:64367014-64367036 GCAGGGATGGAGGTTATGAATGG + Intergenic
1109950902 13:69501364-69501386 GCAGGGATGGAGGTTATGCATGG - Intergenic
1110362502 13:74643249-74643271 GCAGGGAAAGAAGACATGCATGG + Intergenic
1110377285 13:74807358-74807380 GCAGGGATGGAGGTTATGCACGG + Intergenic
1110597706 13:77337409-77337431 GCAAGGACGGAGGTTATGCATGG + Intergenic
1110812818 13:79829274-79829296 GCAGGGCAGGATGCTATGCATGG + Intergenic
1110815547 13:79856721-79856743 GCAGGGATGGAGGTTATGCATGG + Intergenic
1110834020 13:80063783-80063805 GCAGGGATGGAGGTTACACATGG - Intergenic
1110867906 13:80418632-80418654 GTGGGGATGGAAGTTATGGGTGG - Intergenic
1111016337 13:82387040-82387062 GCAGGGATGGAGATTATGTGTGG - Intergenic
1111057673 13:82972178-82972200 GCAGGGATGGAGGTTACACATGG - Intergenic
1111198652 13:84905733-84905755 GCAAGGATGGAGGTTACACATGG + Intergenic
1111317618 13:86582646-86582668 GCAGGGATGGAGGTTACGCATGG + Intergenic
1111432151 13:88158924-88158946 GCAGGGGTGAAAGCCATGCACGG - Intergenic
1111498335 13:89083869-89083891 TCTGGGATGGGAGTTATGCATGG + Intergenic
1111556874 13:89892367-89892389 GCAGAAATGGAAGCTCTGCATGG - Intergenic
1112057602 13:95705170-95705192 GCAGGGATGGAGATTATGAATGG - Intronic
1112249813 13:97769457-97769479 ACAGGGATGGAGGTTACACATGG - Intergenic
1112981777 13:105393779-105393801 TCAGGGATGGAGGCTACGCATGG - Intergenic
1113319578 13:109220827-109220849 GCAAGGATGGAGGTTATGCATGG - Intergenic
1114205985 14:20571614-20571636 GCAGGGATGGAGGTTATGCATGG + Intergenic
1114758132 14:25283032-25283054 GCAGGGATGAAAGTTACACATGG - Intergenic
1114896248 14:26994493-26994515 GCAGGAAAGGAGGTTATGCACGG - Intergenic
1114905273 14:27119712-27119734 GCAGGGATGGAGGTTACACATGG - Intergenic
1115059828 14:29174729-29174751 GCAGGGATGGAGGTTATGCATGG + Intergenic
1115328296 14:32166626-32166648 GCAGGGCTGGAGGCTATTCATGG + Intergenic
1115394261 14:32890487-32890509 GCAGGGATGGTAAATGTGCAAGG - Intergenic
1115829965 14:37326676-37326698 GCAGGCATGGAAGTTCTGCAAGG - Intronic
1116023139 14:39485349-39485371 ACAGGGATGGAGGCTATGCCCGG + Intergenic
1116023186 14:39485803-39485825 ACAGGGATGGAGGCTATGCATGG - Intergenic
1116116345 14:40656463-40656485 GCAGGCATGAAGGTTATGAATGG - Intergenic
1116158262 14:41235812-41235834 GCAGGGATGGAGGTTACACATGG - Intergenic
1116249165 14:42458481-42458503 GCAGAGATGGAGATTATGCATGG + Intergenic
1116415183 14:44670141-44670163 GCAGGGATGAAGGTTTCGCATGG + Intergenic
1116531341 14:45977393-45977415 GCAGCGATGGAGGTTACACATGG - Intergenic
1116784095 14:49268735-49268757 GCTGGGATGGCTGTGATGCAGGG - Intergenic
1117216971 14:53561021-53561043 ACAGGGATGGAGGTTATGCATGG + Intergenic
1117780003 14:59222561-59222583 GCAGGGATGGAGGTTAGGCATGG - Intronic
1118122317 14:62859332-62859354 GCAGGGATGGAGGTTATGCATGG - Intronic
1118880652 14:69823169-69823191 GCAGGGATGGAGGTTACACATGG - Intergenic
1118950633 14:70433727-70433749 GCAGGGAAGGAGGTTATGTATGG - Intergenic
1119107436 14:71937996-71938018 GCAGGGATGGAGGTTATGCATGG - Intronic
1120132484 14:80823693-80823715 ACAGGGGTGGAAGCTGTGCAGGG - Intronic
1120498286 14:85262737-85262759 GCAGGGATGGAGGTTACGCATGG - Intergenic
1120555870 14:85929590-85929612 GGAGGGATGGAGGTTACGCATGG - Intergenic
1120710366 14:87787302-87787324 GCAGGGATGGAGGTTATGTGTGG - Intergenic
1120919808 14:89744562-89744584 GCAGGGATGGAGGTTACGCATGG + Intergenic
1120947257 14:90010236-90010258 GCGAGGAAGGAAGTTATCCAAGG - Intronic
1120973822 14:90231644-90231666 GCAGGGATGGAGGTTATGCATGG + Intergenic
1121070594 14:91017065-91017087 GCAGAGATGGTGGTTACGCATGG + Intronic
1121385637 14:93521229-93521251 ACAGGGCTGGAAGATATTCAAGG - Intronic
1121932130 14:97981888-97981910 GTAGGGAAGGAAATTCTGCACGG + Intergenic
1122347809 14:101071311-101071333 GCAGGGATGGGATTTTTCCAAGG + Intergenic
1122841330 14:104465210-104465232 GCAGGGATGGAGGTAGTACATGG - Intergenic
1202935363 14_KI270725v1_random:82852-82874 TCAGGGATGGAGGCTATGCATGG - Intergenic
1123908388 15:24942859-24942881 GCAGGGATGAAGGTTACGCATGG - Intronic
1123978362 15:25574353-25574375 GCAGGAATGGAGGCTATGCATGG - Intergenic
1124571325 15:30866852-30866874 GCAGGGATGGAGGTTATGCATGG - Intergenic
1125605035 15:40935329-40935351 ATAGGAATGGAAGCTATGCAGGG - Intronic
1126199914 15:45974041-45974063 GCAGGGGTGGAGGGTATGTATGG + Intergenic
1127118151 15:55747492-55747514 GCAGTGATGGAGGCTATGCATGG + Intergenic
1130377038 15:83338411-83338433 ATAGGGATGAAGGTTATGCATGG + Intergenic
1131580530 15:93638540-93638562 GCAGGAATGGAAACTCTGCATGG - Intergenic
1131724137 15:95203646-95203668 GCAGGAATGGAGGTTATGCATGG + Intergenic
1132858386 16:2057777-2057799 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858395 16:2057806-2057828 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858404 16:2057835-2057857 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858413 16:2057864-2057886 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858422 16:2057893-2057915 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858431 16:2057922-2057944 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858440 16:2057951-2057973 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858449 16:2057980-2058002 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1132858458 16:2058009-2058031 GCAGGGCTGGGAGAGATGCAGGG - Intronic
1133703819 16:8334299-8334321 GGATGGATGGGAGTTAGGCAAGG - Intergenic
1134399088 16:13892425-13892447 GCAGGGATGGAGGCCATGCATGG + Intergenic
1135061513 16:19275122-19275144 GCAGGGATGGAGGTTATACATGG - Intergenic
1135418028 16:22283913-22283935 GCAGCGATGGAAGCCATGAAGGG + Exonic
1135626123 16:23996345-23996367 GCAGGGATGGAGGTTATGCATGG + Intronic
1135892677 16:26371631-26371653 GCAAGGAAGGAAGTTAAGAAAGG + Intergenic
1136251059 16:29005416-29005438 GCAGGGATGGAGGTTACGCATGG + Intergenic
1137511195 16:49102189-49102211 GCAGGGACTGAGGCTATGCATGG - Intergenic
1137652648 16:50133836-50133858 TCAGGGATGGAGGTTAATCATGG - Intergenic
1138468863 16:57215368-57215390 GCAGGGATGGTGGTTATGTGAGG + Intronic
1138868494 16:60851630-60851652 GCAGGGATGGAGGTTACTCATGG + Intergenic
1140874092 16:79134421-79134443 GGAGGGACTGAAGTTATACAGGG + Intronic
1141559426 16:84857192-84857214 GCAGGAGTGGAGGTTATGCATGG - Intronic
1142588234 17:987735-987757 GCAGGGATAAAGGTTATTCATGG - Intergenic
1143130645 17:4674968-4674990 GCAAAGATGGCAGTTATGAATGG + Intronic
1144596949 17:16577920-16577942 GCAGGCATGGAGGCTGTGCATGG + Intergenic
1146238105 17:31186794-31186816 GCAGGGATGGAAGTTATGCATGG + Intronic
1146758552 17:35454978-35455000 GCAGGGATGGCGGTTATGCATGG + Intergenic
1146836476 17:36114821-36114843 GCAGGGATGGAGGTTATACATGG + Intergenic
1146851057 17:36221880-36221902 GCAGGGATGGAGGCTACACATGG + Intronic
1148628803 17:49090964-49090986 GCAGGGGTGCAGGCTATGCATGG + Intergenic
1149036578 17:52141115-52141137 GCTGGGATGGCAGTTCGGCAGGG - Intronic
1149427196 17:56566513-56566535 GTAGAGATGGAGCTTATGCATGG + Intergenic
1149481794 17:57009431-57009453 GCGGGGATGGAGGCTATGCATGG + Intergenic
1153049237 18:885525-885547 GCAGAGATGGAGTCTATGCATGG + Intergenic
1153089833 18:1331006-1331028 GCAGGGATGGAGGTTACACATGG + Intergenic
1153131155 18:1856879-1856901 GCAGGGATGGAAGTTATGTATGG - Intergenic
1153184514 18:2471570-2471592 GTAGGGATGGAGGTTATGCATGG + Intergenic
1153217565 18:2834759-2834781 GCAGGGATGGAGGTTATGCATGG - Intergenic
1154068589 18:11131926-11131948 GCAGGGTTGGAGGTTATACATGG + Intronic
1154252443 18:12755841-12755863 GCAGGGATGGAGGTTACACATGG - Intergenic
1155234202 18:23803361-23803383 GCAGGGATGGAGTTTATCCCTGG - Intronic
1155336869 18:24773906-24773928 GCAGGGATGTAGGTTATCCCTGG - Intergenic
1155420267 18:25648314-25648336 ACAGGGATGGAAGCTATGCATGG - Intergenic
1156063952 18:33117336-33117358 AATGGGATGGAGGTTATGCATGG + Intronic
1156118558 18:33816567-33816589 GCAGGGATGGAGATTATGCATGG + Intergenic
1156303977 18:35859538-35859560 GGAGGGATGGAGGTTATGCATGG + Intergenic
1156990184 18:43399932-43399954 GCAGGGATGGAGGTTACACATGG - Intergenic
1156998692 18:43498572-43498594 GCAGGAATGGAGGTTATGCATGG + Intergenic
1157341329 18:46780855-46780877 GCAGGGATGGAGGTTAAGCATGG + Intergenic
1157963463 18:52182227-52182249 GTAGGGATAGAGGTTATGCATGG + Intergenic
1157998380 18:52587281-52587303 GTAGGGATGGAGGTTACACATGG - Intronic
1158776002 18:60580614-60580636 GGAGGGATGGGAGTTTTGAAGGG + Intergenic
1159151779 18:64531865-64531887 GCAAGAATGGAAGTTATGCATGG - Intergenic
1159168384 18:64730948-64730970 GCAGGCATGGAACTTCTACATGG + Intergenic
1159272379 18:66169151-66169173 ACAGGGGTGGAGATTATGCATGG - Intergenic
1159713110 18:71788063-71788085 GCACGGTTAGAAGTTGTGCATGG + Intronic
1159758384 18:72394105-72394127 GCAGAGATGAAAGCTATGCATGG + Intergenic
1159827525 18:73232362-73232384 GCAGGGATGTAATTTAGGCAGGG + Intronic
1159858323 18:73615826-73615848 ACAGGAATGGAGGCTATGCATGG - Intergenic
1160092565 18:75840858-75840880 GCAGGGATGGAGGTTACGCATGG + Intergenic
1162038783 19:7956884-7956906 GCAGGGATGGAAGCCATCCCTGG + Intergenic
1165155440 19:33784330-33784352 ACAGGGATGGAGGTTATGCATGG + Intergenic
1165223993 19:34341213-34341235 GCAGGACTGGAAGTTCTGCTAGG - Intronic
1165405881 19:35630851-35630873 GCTTGGATGGAGGTTGTGCATGG + Intronic
1165406081 19:35632239-35632261 GCAGGGTTGGAAGCTGGGCAGGG - Intronic
1165497513 19:36162154-36162176 GCAGAGATGGAGGCTATGCATGG - Intergenic
1165560212 19:36672527-36672549 GCAGTGATGAAAGTTATGCATGG + Intergenic
1167951742 19:53033084-53033106 GCAGGGATGGAGGTTACACATGG + Intergenic
1168539211 19:57196562-57196584 GCAGGGATGGAGGTTGCGCATGG - Intronic
925280077 2:2677705-2677727 GCAGTGATGGAGGTTACACATGG + Intergenic
925460845 2:4061285-4061307 GCAGGGATGGAGGTTACACATGG + Intergenic
925772626 2:7298171-7298193 GCAGTGATGAAAGTTATTCATGG - Intergenic
926810275 2:16749834-16749856 GCAGGAATGAAGGTTATGCATGG - Intergenic
926826889 2:16914512-16914534 GCAGGGACGGAGGTGAGGCATGG + Intergenic
927008834 2:18880568-18880590 GCAGGGATGGAGGTTATACATGG + Intergenic
929269706 2:39959955-39959977 GCAGCAATGGTTGTTATGCATGG - Intergenic
929550425 2:42887189-42887211 GCAGAGATGGAGGTTATGCTGGG + Intergenic
929894437 2:45946168-45946190 GCAGGGATTTAAGGGATGCAGGG - Intronic
930132665 2:47868667-47868689 GGAGGAATGGAGGTTATACATGG + Intronic
930295089 2:49544531-49544553 GTAGGGATGGAGGTTATGCGTGG - Intergenic
930331988 2:49996644-49996666 GCAGGGATCAGAGTGATGCAAGG + Intronic
930418711 2:51121821-51121843 GCAGGGATGGAGGTTATGCATGG + Intergenic
930481049 2:51948409-51948431 GCAGGGATGGAGGTTACACATGG - Intergenic
930901097 2:56508598-56508620 GCAAGGATAGAGGCTATGCATGG - Intergenic
930910258 2:56621708-56621730 GTAGGGATGGAGGTTACACATGG + Intergenic
932139561 2:69263541-69263563 GTGGGGATGGAGGTCATGCAAGG + Intergenic
932331227 2:70899649-70899671 GCACGGCTGGAAGTGAAGCAGGG - Intergenic
932807909 2:74798659-74798681 GCAGGGGTTGAGGTTCTGCAAGG - Intergenic
932870578 2:75394241-75394263 GGAGGGATGGAGGTTATACATGG - Intergenic
933265572 2:80177531-80177553 ACAGAGATGGAGGTTATGCATGG - Intronic
933394351 2:81712514-81712536 GCAGGGATGGAGGTTAAGCATGG - Intergenic
934050649 2:88207711-88207733 GCAGGGATGGAAGTCATGCATGG + Intergenic
934126186 2:88893033-88893055 GCAGGAATGGAGCTTATGCATGG + Intergenic
934305860 2:91821438-91821460 GCAGGGATGGAGGCTATGCATGG + Intergenic
934327396 2:92031304-92031326 GCAGGGATGGAGGCTATGCATGG - Intergenic
934465780 2:94261884-94261906 GCAGGGATGGAGGCTATGCATGG - Intergenic
935184066 2:100715741-100715763 GCAGGGATGGAGGTTACGCATGG + Intergenic
935424987 2:102910482-102910504 CCAGGGATGGAGGTTACACATGG - Intergenic
935564180 2:104589405-104589427 GCAGGGATGGAAGTTACGTATGG - Intergenic
935728424 2:106044302-106044324 TCAGGGATGGAAGTTTTCGAAGG - Intergenic
935823325 2:106916032-106916054 GCAGGGGTGGAGATGATGCATGG + Intergenic
935930448 2:108118421-108118443 GCAGGGATTGAGCTTATGCTGGG - Intergenic
936147549 2:109990901-109990923 GCAGGGGTGGAGGTGATGCCTGG - Intergenic
936197143 2:110380540-110380562 GCAGGGGTGGAGGTGATGCCTGG + Intergenic
936562929 2:113557472-113557494 GCAGGGATGAAGGCTATGCACGG - Intergenic
936646253 2:114376126-114376148 GTAGGAATGGAGGTTATGCTTGG - Intergenic
936992701 2:118383044-118383066 GCAGGGCTGGGAGGGATGCAAGG + Intergenic
937007039 2:118526407-118526429 GAAGGGATGGAGGCTATGCATGG + Intergenic
937520250 2:122705351-122705373 GCGGAGATGGAGATTATGCATGG - Intergenic
937581948 2:123498304-123498326 GCAGGGATGGAGGTTATGAATGG - Intergenic
937765751 2:125658828-125658850 CCACGGATGGAAGTCACGCATGG + Intergenic
937785078 2:125886884-125886906 GCAGAGATGGAGGCTATGCATGG - Intergenic
937852450 2:126647892-126647914 GCAGGGATGGAAGTTACGCATGG - Intergenic
938764089 2:134448915-134448937 CCAGGGACAGAAGTCATGCAGGG + Exonic
939069202 2:137518730-137518752 GCAGGGATGGAGGTTACGCATGG + Intronic
939075795 2:137601293-137601315 GCAGGACTGGAAGTTGTGCCAGG - Intronic
939213989 2:139213081-139213103 GCAGGGATGGAGATTATGCATGG + Intergenic
939806354 2:146779315-146779337 GCAGGGATGGAGGCTATGCATGG + Intergenic
940359406 2:152781495-152781517 TCAGGGATGGAGATTATACAGGG - Intergenic
940605800 2:155923444-155923466 GCAAGCATAGAGGTTATGCATGG - Intergenic
942322061 2:174744350-174744372 GCAGGGATGGAGGTTATGCATGG + Intergenic
942342299 2:174961158-174961180 GCAGGGAGGGAAGGAATGGAAGG + Intronic
942719796 2:178938779-178938801 GCAGGGATGTAATGTATCCAAGG + Intronic
943317803 2:186411474-186411496 GCAGGGATGGAGGTTATGCATGG - Intergenic
943385776 2:187202395-187202417 GCAGGAATGGAGGTGATGCATGG - Intergenic
943480486 2:188411428-188411450 GCAGGGATGGAGGTTAGGCATGG - Intronic
943517475 2:188906412-188906434 GCAGGGATGGAGGTTATGCATGG - Intergenic
943833493 2:192490301-192490323 TCAGGGAGGGAGGTTATTCATGG - Intergenic
944406048 2:199385050-199385072 GCAAGGATGGAAGAAATGAATGG - Intronic
944437550 2:199706390-199706412 ACAGAGATAGAGGTTATGCATGG - Intergenic
945544975 2:211138953-211138975 GCAAGGATGGAGGTTATGCATGG + Intergenic
945642300 2:212444681-212444703 GCAGGGATGGAGGTTATGCATGG + Intronic
945717721 2:213379826-213379848 GCAGGGATGGAGGTTACGCATGG - Intronic
945725728 2:213470658-213470680 GGAGGATTGGAGGTTATGCATGG - Intronic
946151019 2:217770697-217770719 GCAGGGATGGAGGTTACACAAGG + Intergenic
946527754 2:220539192-220539214 GCAGGGATGGAAGTTACACATGG - Intergenic
946703639 2:222436950-222436972 GCAGTGATGGAGGTTACGCATGG - Intronic
946873430 2:224105617-224105639 GTAGGGATGGAGAATATGCATGG - Intergenic
947440967 2:230121097-230121119 GCAGGGATGGAGGTTATGCTTGG + Intergenic
948105769 2:235412449-235412471 CCAGAGATGGCAGTTATGGAGGG - Intergenic
948340324 2:237245518-237245540 GCAGGGATGGAGGGGATGCATGG - Intergenic
1169610986 20:7379890-7379912 GTAGGAATGGAGGTTATGCATGG - Intergenic
1171266592 20:23776389-23776411 GCAGGGAGGGAGGTTATGGGGGG - Intergenic
1171276153 20:23858039-23858061 GCAGAGATGGAGGTTATGGGCGG - Intergenic
1171315976 20:24195056-24195078 GCAGGGAGGGATGTTATGCATGG + Intergenic
1171329946 20:24328799-24328821 GCAGGGATGGAGGTTATGCATGG - Intergenic
1171409690 20:24937790-24937812 GCAGGGATGGAGGTTGTGCATGG - Intergenic
1171436246 20:25126789-25126811 GCAGGGATGGAGCTTACACATGG + Intergenic
1173141798 20:40491249-40491271 GCGGGGATGGAGGTTTTGCATGG - Intergenic
1175038901 20:56027084-56027106 GCAGGGATGGAAGATGTGCATGG - Intergenic
1175183563 20:57165167-57165189 ACAGGGATGGAGGTACTGCAGGG - Intergenic
1176596783 21:8705088-8705110 TCAGGGATGGAGGCTATGCATGG - Intergenic
1177149314 21:17438819-17438841 GCAGGGATCAAAGCTAAGCAGGG - Intergenic
1177505445 21:22013361-22013383 GCAGAGATGGAGGTTACACATGG - Intergenic
1177731030 21:25026585-25026607 GCAGAGATGGAGGTTATGCATGG + Intergenic
1177780858 21:25621275-25621297 GCAGGGATGGAAGTCATGCAGGG - Intergenic
1178005923 21:28219589-28219611 GCAAGGATGGTTGTTATGCATGG - Intergenic
1179255575 21:39712615-39712637 ACAGGGAAGGAGGCTATGCATGG - Intergenic
1179415023 21:41191693-41191715 GCAGGGATGGAGGTTACACATGG - Intronic
1179457977 21:41512739-41512761 GCAGGGATGGAGATTATGCATGG - Intronic
1180279703 22:10682530-10682552 TCAGGGATGGAGGCTATGCATGG - Intergenic
1180586921 22:16901060-16901082 GCAGGGATGGAGGCTATGCATGG - Intergenic
1180591029 22:16937522-16937544 GCAGGGATGGAGGCTATGCATGG - Intergenic
1181367271 22:22387687-22387709 GCAGGAATGGAGGTTACACATGG - Intergenic
1181406455 22:22688360-22688382 GCAGGGATGGAGGCTGTCCATGG - Intergenic
1181868721 22:25880784-25880806 ACAGTGATGGAGGTTAAGCATGG + Intronic
1182009194 22:26986242-26986264 GCAGGCATGGAAGGTAAGGAGGG + Intergenic
1182965829 22:34520142-34520164 GCAGGGATGGTGGTTATGCGTGG + Intergenic
1183859892 22:40662242-40662264 ACAGGGATGGAGGTTAAGCATGG + Intergenic
1184603443 22:45557522-45557544 GCAGGGATGGAGGTTACACATGG - Intronic
1184638563 22:45856189-45856211 GCAGTGATGAAGGCTATGCATGG - Intergenic
949245993 3:1925768-1925790 GCAGGGATGGAAGTTATGCATGG + Intergenic
949445732 3:4131902-4131924 GCAAGGATGGAGGTTACACATGG + Intronic
951003686 3:17593330-17593352 GCAGGGATGGAGGTTACACACGG + Intronic
951291403 3:20875899-20875921 GTAGGGATGGAGGTTATGCATGG - Intergenic
951384634 3:22028362-22028384 GCAGGGATGGAGGTTACGCATGG + Intronic
951970645 3:28441043-28441065 GCAGGGATGGAGGTTATGCATGG - Intronic
952587621 3:34911805-34911827 GCAAGGATGGAGATTATGCATGG - Intergenic
953038928 3:39237768-39237790 GCAGGGGAAGAAGTTAAGCAAGG - Intergenic
953805023 3:46061367-46061389 GCAGGAATTGAAGTTATGCATGG - Intergenic
954003257 3:47574104-47574126 CCTGGGATGGAAGCTAAGCAAGG + Intronic
954054281 3:48008783-48008805 GCAGGGATGGAAGTAATGCTTGG + Intronic
954511363 3:51128822-51128844 GCAGGGATGGAGGTTACGCTTGG - Intronic
954834497 3:53453826-53453848 GCAGGGCTGGAGGATACGCATGG - Intergenic
955418517 3:58715016-58715038 ACAGGGATGGAGGTTATGCATGG - Intergenic
955801767 3:62694081-62694103 GCAGGGATAGAAGCTACACATGG + Intronic
956306985 3:67836474-67836496 GCAGGGATGGAGGTTACTCATGG + Intergenic
956509787 3:69981209-69981231 GCAGGGATGGAGGTTACACATGG + Intergenic
956519072 3:70083740-70083762 GCAGGGAAGGAAGTCAAGGAAGG - Intergenic
956928884 3:74020166-74020188 ACAGGGATGAAAGTTATCAATGG + Intergenic
957247449 3:77733056-77733078 GCAGGCATGGAGGTTATGCATGG - Intergenic
957298401 3:78360805-78360827 GCAGGAATGGAAATTATGCTGGG - Intergenic
957421754 3:79980232-79980254 GCAGGGATGTAGGTTATGAATGG - Intergenic
957754709 3:84470271-84470293 GCAGGGATGGAGGTTATGCATGG + Intergenic
957812095 3:85236139-85236161 GCACGGATGGATGTTTTGCTGGG - Intronic
958186544 3:90127979-90128001 GCAGGACTGGAAGTTATTCTGGG - Intergenic
958258893 3:91355888-91355910 GCAGGGATGGAGGTTGTGCATGG - Intergenic
958474109 3:94558644-94558666 GCAGGGATGAAGGTTATGCATGG + Intergenic
958487558 3:94731630-94731652 GCAGAGATGGAGGTTACACATGG - Intergenic
958751821 3:98200950-98200972 ATAGGGATGGATGTTATGCCTGG - Intergenic
958934427 3:100241455-100241477 GCAGGGATGGAGGTTATGCATGG + Intergenic
959120972 3:102231587-102231609 GCAGAGATGGAAGTTCTGTAGGG + Intronic
959226659 3:103596437-103596459 GCAGGGATGGAGGTTACACATGG - Intergenic
959237745 3:103746295-103746317 GCAAGGATGGAGGTTAGGTATGG - Intergenic
959289746 3:104458808-104458830 GCAGGGCTGGAAGCTAGGCATGG - Intergenic
959439630 3:106360026-106360048 GCAGTGATGGAGGTTATGCATGG + Intergenic
959745896 3:109776431-109776453 GCAGGGATGGAGGTTATGCATGG - Intergenic
959793555 3:110394289-110394311 GCAGGGATGGAGGTCATGCATGG - Intergenic
959997988 3:112699163-112699185 GCAGGGATGGAGGTTACACATGG + Intergenic
960349638 3:116576544-116576566 GCAGGAATGGAGGTTGTGCATGG + Intronic
960357023 3:116665896-116665918 GCAGGACTGGAAATTATGCTGGG + Intronic
960458833 3:117907825-117907847 GCAGGGCTGGAAGTTATTCTGGG - Intergenic
960755640 3:121009078-121009100 GCAGGAATGGAGGCTACGCATGG - Intronic
961262969 3:125617231-125617253 GCAGGGATGGAGGTTATTCATGG + Intergenic
961710858 3:128827175-128827197 GCAGGGATGGAGGTTACACATGG - Intergenic
962165774 3:133046211-133046233 GATGGGATGGAATCTATGCATGG + Intronic
962214787 3:133511916-133511938 GCAGGGATGGAGGTTATTCATGG + Intergenic
963269449 3:143271334-143271356 GCAGGGCTGGCATTTATGCCTGG - Intronic
963331689 3:143922530-143922552 GCAGGGATGGAGGATACTCATGG - Intergenic
963379124 3:144506440-144506462 GCAAGGATGGAGGTTACGCATGG - Intergenic
963569117 3:146969841-146969863 TCAAGGATGGAAATTATGCATGG + Intergenic
963599374 3:147364625-147364647 GTAGGGAAGAAAGTTATGGAAGG + Intergenic
963661510 3:148132981-148133003 GCAGGGATGGAGGTTATGCATGG + Intergenic
963688697 3:148471409-148471431 GCAGAAATGGAGATTATGCATGG - Intergenic
964297791 3:155252776-155252798 GTTGCGATGGAAGCTATGCATGG + Intergenic
964679115 3:159318070-159318092 GCAGGGATGGAGGTTACACATGG - Intronic
965213587 3:165829634-165829656 GAATGGATGGGAGTGATGCATGG - Exonic
965226642 3:165999927-165999949 GCAGGGATGGAGGCTCTGCATGG - Intergenic
965259816 3:166467653-166467675 TCAAGGGTGGAGGTTATGCAAGG + Intergenic
965835939 3:172852807-172852829 GCAGGGTTGGAAGTCAGGGAGGG + Intergenic
966044210 3:175530076-175530098 ACAGGGATGGAAGTTACACATGG - Intronic
966277179 3:178187932-178187954 GCAGGAATGGAAGTAATTTAAGG + Intergenic
967235115 3:187376674-187376696 GTAAGAATGGAAGGTATGCATGG - Intergenic
967235446 3:187379458-187379480 GAAGGGAAGGAAATTATGAAAGG + Intergenic
967330204 3:188282576-188282598 GCAGGGATGTCACTTATGCCAGG - Intronic
967831911 3:193926832-193926854 GCAGGGATGGAGGTTACACATGG + Intergenic
968765215 4:2464784-2464806 GCAGTGAGGGAAGGTCTGCATGG + Intronic
968800312 4:2738973-2738995 GCAGGGATGGAGATTACACATGG + Intergenic
968907133 4:3459255-3459277 GCAGGGATGGAGATTACACATGG + Intergenic
968981827 4:3854443-3854465 GCAGGGAGGGAGACTATGCATGG + Intergenic
969897884 4:10322110-10322132 GCTTGGATGCAGGTTATGCAGGG + Intergenic
970334959 4:15027511-15027533 GCAGAGATTGGAGTTATTCAAGG + Intronic
970524103 4:16913909-16913931 TCAGGGATGGAGGCTATGCATGG + Intergenic
970629402 4:17924346-17924368 GCAGGGATGGAGGTTACACATGG + Intronic
971817345 4:31505916-31505938 GCAGGGATGGAGGTTATGCATGG + Intergenic
971857539 4:32062011-32062033 GCAGGGATGGAGGTTATACATGG - Intergenic
971979185 4:33732030-33732052 GCAGGAATGTAGGTTATGCATGG - Intergenic
972085336 4:35207929-35207951 GCATGGATGGAGGTTACACATGG + Intergenic
972093329 4:35316723-35316745 GCAGGGGTAGAAGTTATGTATGG + Intergenic
972201188 4:36716339-36716361 GCAGGGATGGAGGTTATGCATGG - Intergenic
972696825 4:41454692-41454714 GCAGAGACGCAAGCTATGCAGGG + Intronic
972806040 4:42530172-42530194 GCAAGGATGGAGGTTACGCATGG + Intronic
972882854 4:43447329-43447351 GCAGGGATGGAGGTTATGCATGG - Intergenic
973092700 4:46157939-46157961 GCAGGGATGGTGCTTATGCATGG + Intergenic
973098148 4:46227527-46227549 GCAGAAATGGTGGTTATGCATGG + Intergenic
973103035 4:46295586-46295608 GCAGGGATGGAGCTTATGCATGG + Intronic
973118550 4:46489888-46489910 GCAGGGATGGAGGTTATGCATGG + Intergenic
973130062 4:46638847-46638869 GCTGGAATGGAGGTTATGCATGG - Intergenic
973824530 4:54691827-54691849 GCAGGAATGGAAGGGATACAGGG + Intronic
974551062 4:63375070-63375092 GAAGGGACGGAAGCTATACAAGG + Intergenic
974564901 4:63569154-63569176 GCAGGGATGGAGGTTATGCATGG + Intergenic
974688613 4:65266423-65266445 GCATGGATAGAGGTTATGCATGG + Intergenic
974727341 4:65813381-65813403 GCAGGGATGGAGGTTAGGCATGG + Intergenic
974975569 4:68887275-68887297 GCATTGATGGAAGTTATGCATGG - Intergenic
975348000 4:73315833-73315855 GCAGGGATGGAGGCCATGCATGG + Intergenic
975386598 4:73766669-73766691 GCAGGGATGGAGGTTACACATGG - Intergenic
975742307 4:77441558-77441580 GCAGGGATGGAGGTTATGCATGG + Intergenic
975860599 4:78672716-78672738 GCAGGGAGGGAAGTAAGGAAGGG - Intergenic
975982483 4:80176434-80176456 GCAGGGATGGAGGTTACACATGG - Intergenic
976034088 4:80794979-80795001 GCAGGGATGGATGATATGTATGG - Intronic
976697902 4:87937741-87937763 GCAGGAATGGAGGCTATGCATGG - Intergenic
976896247 4:90115673-90115695 GGAGGGATGGAGGTTATGCATGG + Intergenic
977031764 4:91892653-91892675 GCAGGGGTGGAGGTTACTCATGG + Intergenic
977089363 4:92651387-92651409 GCAGGGATGGAAGTTAGGCATGG - Intronic
977293907 4:95191698-95191720 GCAGGGAAGGAGGGTAAGCAGGG - Intronic
977430886 4:96929054-96929076 GCCGGGATGGAGGTTACACATGG + Intergenic
977466127 4:97384219-97384241 GCAGGGATGGAGATTACACATGG + Intronic
977489963 4:97699230-97699252 GCAGTGATGGAGGTTATGCATGG - Intronic
977833109 4:101616996-101617018 GCAGGGATGGGGGTTACACATGG - Intronic
977847001 4:101778420-101778442 GCAGGGATGGAAGTTATGCATGG - Intronic
977898829 4:102395429-102395451 GTAGGGATGGAGGTTATGAATGG + Intronic
977930283 4:102742975-102742997 GCAGGGATGGGGGTTACACATGG - Intronic
978341457 4:107724704-107724726 GCAGGGATGGAGGTTATGCATGG - Intergenic
978432282 4:108645276-108645298 GGAGGGATGGAAGCTATGCATGG - Intergenic
978485803 4:109252384-109252406 GCAGGGATGGAGGTTATACATGG - Intronic
978715502 4:111837975-111837997 GCAGGAATGGAAGTTATTGCAGG - Intergenic
978772034 4:112466943-112466965 GCAGGGATGGAGGTTATGCATGG - Intergenic
979048288 4:115897333-115897355 GCAGGGACGGAAATTACGTACGG + Intergenic
979767129 4:124475439-124475461 GCAGGGAGGGAGGTTATGCATGG + Intergenic
979888452 4:126061334-126061356 TCAGGGATGGAGCTTATGCATGG - Intergenic
979898294 4:126188223-126188245 GAAGAGATGGAAGTCGTGCATGG - Intergenic
980385674 4:132086216-132086238 GCAGGGATGGAGGTTAGGCATGG - Intergenic
980957847 4:139446758-139446780 GCAGGGATGGAGGTTACATATGG + Intergenic
981462932 4:145032637-145032659 GCAGGAATGGAGGTTACACATGG + Intronic
981835120 4:149044784-149044806 GCAGGGATGGAGGTTATGCAAGG + Intergenic
981854744 4:149274921-149274943 GAAAGCATGGAAGGTATGCAAGG + Intergenic
981856976 4:149306472-149306494 GCAGGGAAGGAAGTAATAAAGGG - Intergenic
981873657 4:149516041-149516063 GCAGGGATGGAGGTTATGCATGG + Intergenic
981979264 4:150771776-150771798 GCAGGGATGGAGGTTATCCAAGG - Intronic
982293105 4:153799200-153799222 GCAGGGAAGGATGTTAAGGATGG + Intergenic
982293119 4:153799254-153799276 GCAGGGAAGGATGTTAAGGATGG + Intergenic
982597659 4:157406200-157406222 GCAGGGATGGAAGTTATGCCTGG - Intergenic
982623217 4:157732044-157732066 GCAGGGATGGAGGTTATGCACGG - Intergenic
982786833 4:159545986-159546008 GCAGAGATGGAGGCTATTCATGG - Intergenic
982835668 4:160117489-160117511 GCAGGGATGGAGGTTATGCATGG + Intergenic
982847899 4:160275144-160275166 GCAGGGATGGAGGTTATGCATGG + Intergenic
983027521 4:162756132-162756154 ACAGGGATGGACGTTACTCATGG + Intergenic
983185191 4:164692418-164692440 GCAGGGATGGAGGTTATGCATGG + Intergenic
983355860 4:166656513-166656535 GCAGAGATGGAGGCTATCCATGG + Intergenic
983459826 4:168014377-168014399 GCAGGGATGGGAGCGATGCATGG - Intergenic
984060166 4:174981184-174981206 GTAGGGACAGAGGTTATGCATGG - Intergenic
984093843 4:175409736-175409758 GCAGGGATGGAGCTTACGCATGG + Intergenic
984405554 4:179325159-179325181 GCAGGAATTGAGGTTATGCATGG - Intergenic
984661929 4:182383607-182383629 GGAGGGATGGAAGACAGGCATGG - Intronic
985832447 5:2244149-2244171 GCACGTTTGGAGGTTATGCATGG + Intergenic
986036923 5:3949607-3949629 GCAGGGATGGAGGATACACATGG - Intergenic
986087223 5:4463561-4463583 GCAGGGATGGAGGTTACACATGG + Intergenic
986261512 5:6151680-6151702 GCAGGTTTGGAGGTTATGCATGG - Intergenic
986531281 5:8739479-8739501 GCAGGGATGGAGGTTATGCATGG - Intergenic
986743073 5:10720602-10720624 GCAGGGATGGAGGTTACGCATGG + Intronic
986766278 5:10931148-10931170 GCAGGGATGGAGGTTACGCATGG + Intergenic
986959949 5:13200027-13200049 GCAGGGATGGAGGTTATGCATGG + Intergenic
987153305 5:15062511-15062533 GCAGGGATGGAGATTATGCATGG + Intergenic
987175494 5:15303963-15303985 GCAGCGATGGAGGCTATACATGG + Intergenic
987472669 5:18351921-18351943 GCAGGGATGGAGGTTAGGCATGG + Intergenic
987490701 5:18577467-18577489 GCAGGGATAGAGGTTACACATGG - Intergenic
987504507 5:18750681-18750703 GCAGGAATGGAGGTTACACACGG + Intergenic
987578223 5:19757467-19757489 GCAGGGATGGAGGTTACACATGG - Intronic
987885567 5:23807344-23807366 GCAGGGATGGAGGTTATGCATGG + Intergenic
987960620 5:24803872-24803894 GCAGAAATGGAGGTTATGCCTGG + Intergenic
987967708 5:24897004-24897026 GCAGAGATGGAAGCTATGCATGG + Intergenic
988153778 5:27422341-27422363 ACAGAAATGGACGTTATGCATGG - Intergenic
988169086 5:27631994-27632016 GCAGGGATGGAGGTGACGCATGG - Intergenic
988205180 5:28124509-28124531 CCAGGGATGGAGGTTACTCATGG - Intergenic
988228872 5:28448969-28448991 GCAGGAATGGAGGTTGTGCACGG + Intergenic
988233183 5:28506246-28506268 GCAAGGATGGATGTTACACATGG - Intergenic
988258276 5:28849385-28849407 GCAGGGATGAGTGTTATGAATGG + Intergenic
988358626 5:30207701-30207723 GCAGGGATTCAGGTTATGCATGG - Intergenic
988924443 5:35975198-35975220 GCAGGGATGGAGTTTATGTATGG + Intronic
989045034 5:37266442-37266464 GCAGGGATGGAGGTTACACCTGG - Intergenic
989097962 5:37798169-37798191 GCAGGGATGGAGGTTATGCATGG + Intergenic
989307383 5:39973779-39973801 ACAGGGATGGAGGTTATGCATGG - Intergenic
989457528 5:41660924-41660946 GCAGGGATGGAGGTTATGCATGG - Intergenic
991033673 5:62106768-62106790 GCAGGGGCGGAGGTTATGCCTGG + Intergenic
991234272 5:64376019-64376041 GCAGGGACGGAGGCTATGCATGG + Intergenic
991330619 5:65488842-65488864 GCAGGGATGGAGGTTACACACGG - Intergenic
991946266 5:71900969-71900991 GCAGGGATGGAGGTTATGCATGG + Intergenic
991953629 5:71971016-71971038 GCAGGGATGAGGGTTATGCCAGG + Intergenic
992099772 5:73395856-73395878 GCAGGGATGGAGGTTATGCAAGG + Intergenic
992243076 5:74790696-74790718 ACAGGGATGGTGGTTACGCATGG + Intronic
992761723 5:79956499-79956521 GCAGGCATGGTAGTCATGCCAGG - Intergenic
993167067 5:84370400-84370422 GGAGGGAAAGAAGTTATGCTTGG + Intronic
993231799 5:85246695-85246717 GCAGGGATGGAGGATATGCATGG - Intergenic
993305768 5:86272988-86273010 GGAGGGATGGAAGTCAGCCATGG + Intergenic
993319937 5:86459423-86459445 GCAGGGATGGAGATTACACATGG + Intergenic
993363079 5:87002043-87002065 GCAGGGATGAAAGCTATGCATGG - Intergenic
993367352 5:87050120-87050142 GCAAGGATGGAGGTTACACATGG - Intergenic
993412456 5:87590974-87590996 GCAGGAATGGAGGTTATGCATGG - Intergenic
993780796 5:92063235-92063257 GCAGGGATGGAGGTTACACATGG + Intergenic
993964700 5:94346733-94346755 GCAGGGATTAAAATTATACAGGG + Intronic
994044979 5:95297340-95297362 GCAGGGGTGGGAGATCTGCATGG + Intergenic
994291247 5:98031110-98031132 GCAGGGATGGAGGTTACTCGTGG - Intergenic
994830251 5:104773119-104773141 GCAGAGATGGAGGCTATGCATGG - Intergenic
994984292 5:106914883-106914905 GCAGGGATGGAGGTTACACATGG - Intergenic
995776161 5:115726856-115726878 GTAGGGATGGAGGTTATGCATGG - Intergenic
996164847 5:120211672-120211694 TCAGGGATGGAAGTTATGCATGG - Intergenic
996392085 5:122972946-122972968 TCAGGGATGGAGGTTATGCATGG - Intronic
996825684 5:127678671-127678693 GCAGGGATGGAAGTTATGCATGG + Intergenic
998258816 5:140612264-140612286 ACAGGGAAGGAAGTGAGGCAAGG - Intergenic
998290211 5:140907709-140907731 GCAGGGATGGAGGTTACACATGG - Intronic
998945096 5:147330460-147330482 GAGGGGCTGGAAATTATGCAAGG + Intronic
1000417090 5:160994745-160994767 GCAGGGATGGAGGTTACTCATGG + Intergenic
1000610584 5:163369239-163369261 GCAGGGAGGGAAGCTCTCCATGG - Intergenic
1002998092 6:2305604-2305626 GCAGGGATGGAGGTTATGCATGG + Intergenic
1003137308 6:3443698-3443720 GCAGGGAGTGAGGTTACGCAGGG - Intronic
1003695777 6:8405318-8405340 ACAGGGATGGAGGTTACTCAGGG - Intergenic
1003758733 6:9150929-9150951 GCAGGGATGGAGGTTACGCATGG + Intergenic
1003791349 6:9550891-9550913 GCAGGGATGGAGGTTACTCATGG + Intergenic
1004824168 6:19402389-19402411 GCAGGGATGGAGGTTATGCATGG - Intergenic
1004840370 6:19577189-19577211 ACAGGGGTGGTAGTGATGCAGGG + Intergenic
1005185298 6:23157909-23157931 GCAGGGATGGAGGTTACACTTGG + Intergenic
1005782807 6:29210840-29210862 GTAGGGATAGAAGCAATGCATGG + Intergenic
1006001669 6:30969918-30969940 TCAGGGATGGAGGTTATGAATGG + Intergenic
1006010276 6:31037275-31037297 GCAGGGATGAAGCGTATGCAAGG - Intergenic
1006106569 6:31720425-31720447 GGAGTGATGGAAGATATGTAGGG - Intronic
1007202975 6:40126235-40126257 GCAGGAATGGAAGCTATGCATGG + Intergenic
1007319027 6:41013065-41013087 GAAGGGATGGAAGCCAAGCATGG + Intergenic
1007573231 6:42908260-42908282 ACAGGGATGGAAGCTATGTCTGG + Intergenic
1008079267 6:47177725-47177747 GCAGGAATGGAGGTTACACATGG - Intergenic
1008340383 6:50357123-50357145 GCAGGGATGGAGGTTATACATGG + Intergenic
1008400406 6:51056310-51056332 GCAGGGATGGAGGTTACACATGG + Intergenic
1008801885 6:55378489-55378511 GCAAGGATGGCAGCTATGCATGG - Intronic
1008996361 6:57664685-57664707 GCAGGGATGGAGGTTGTGCATGG + Intergenic
1009184880 6:60563478-60563500 GCAGAGATGGAGGTTGTGCATGG + Intergenic
1009389989 6:63134230-63134252 GCAGGGATGGAGGTTATGCATGG - Intergenic
1009580301 6:65525007-65525029 GCAAGGATGGAAATTATGCATGG - Intronic
1009770228 6:68136013-68136035 GCAGGGATGGAGGTTATGTGTGG - Intergenic
1009851799 6:69208111-69208133 GCAGGAATGGAGGTTACGCATGG - Intronic
1010107829 6:72189727-72189749 GCAGGAATGGAGGTTACGCATGG - Intronic
1010323689 6:74541335-74541357 GCAGGGACAGAGGTTATGCAGGG + Intergenic
1010325210 6:74555756-74555778 GTAGGGATGGAGGTTACACATGG - Intergenic
1010818749 6:80389253-80389275 GCAGGGATGGAGGTTACACATGG + Intergenic
1010854012 6:80814684-80814706 TCAGGGATAGAGTTTATGCATGG - Intergenic
1010938125 6:81885579-81885601 GCAGGGATGGAGGTTGCACATGG - Intergenic
1011039231 6:83012456-83012478 GCAGGGATGGACCTTATGCACGG - Intronic
1011357777 6:86490201-86490223 GCAGAGAAGGATGTAATGCATGG + Intergenic
1012288693 6:97424088-97424110 GAAGGGATGGATGTCATGCAGGG - Intergenic
1012344706 6:98171166-98171188 GCAGGGATGGAGGTCATGCATGG + Intergenic
1012931274 6:105319730-105319752 GGAGGGATGGAAGTTGGGCAGGG - Intronic
1012964237 6:105656186-105656208 ACAGGAATGGAGGTTATGCCTGG + Intergenic
1013406793 6:109850645-109850667 GCAGGGATGGAGGTCATGCATGG + Intergenic
1014248379 6:119091898-119091920 GCAGGTATGGAGGCCATGCAAGG - Intronic
1014363281 6:120507508-120507530 GCAGGGATGGAGGTTATGCATGG - Intergenic
1014417115 6:121196250-121196272 GCAGGGATGGAGGTTACTCATGG + Intronic
1014446529 6:121534555-121534577 ATAGGGATGGAGATTATGCATGG - Intergenic
1014534066 6:122595759-122595781 GCAGGGATGGAGGTTACACATGG - Intronic
1014631762 6:123797637-123797659 GCAGGGACGGAGGTTACACATGG + Intergenic
1015157299 6:130111158-130111180 GCAAGTAAGGAAGTGATGCAGGG + Intronic
1015443167 6:133271718-133271740 GCAGGGATGGAGGTTACACATGG - Intronic
1015475870 6:133658326-133658348 GCAGGGATGGAGGTTATGCATGG + Intergenic
1015527566 6:134188032-134188054 GCAAGGATGGAGGTTATGCATGG - Intronic
1015660845 6:135571879-135571901 GCAGAGATGAAAGATATACATGG + Intergenic
1015680523 6:135802687-135802709 GCAGCGAAGGAAGCTATGCATGG - Intergenic
1015862160 6:137692326-137692348 GCAGGGATGGAGATTATGCATGG + Intergenic
1016119815 6:140331849-140331871 GCAGGGATGGAGGTTATGCATGG - Intergenic
1016144416 6:140650249-140650271 GCAGGGATGGAAGTTGTGCATGG + Intergenic
1016147207 6:140691870-140691892 GCTTGGATAGAGGTTATGCATGG - Intergenic
1016419491 6:143869825-143869847 GCAGGAATGAAGGTTATGCATGG - Intronic
1016530986 6:145057994-145058016 GCAGTTGTGGAAGTTCTGCATGG + Intergenic
1017043963 6:150330103-150330125 GCAGGGATGGAGGTTATGCGTGG - Intergenic
1017227688 6:152040243-152040265 GCAGGGATGGAGGTTACGCACGG - Intronic
1017976914 6:159366303-159366325 GCAGGGATGGAGGTTACACAGGG - Intergenic
1018349628 6:162943301-162943323 GCAGCGATGGCAGCTATGGATGG - Intronic
1018422889 6:163654646-163654668 GCAGAGATGGAGACTATGCATGG - Intergenic
1018600013 6:165528381-165528403 GCAGGGATGGAGGTTACGCATGG + Intronic
1018863824 6:167732360-167732382 GCAGGGATAGAAGTTAGCCCTGG - Intergenic
1018916452 6:168135278-168135300 GCAGGGGTGGGAGTCATACAGGG + Intergenic
1018954935 6:168403155-168403177 GCAGGGATGGAGGATATGCATGG - Intergenic
1019580207 7:1758267-1758289 GCAGGGAGGGAGGTTCTGCAGGG - Intergenic
1020048589 7:5063911-5063933 GTAGTGATGGAAGCTATGCTAGG + Exonic
1020351337 7:7222034-7222056 GAAGGGAAGGAAGCTAAGCAAGG - Intronic
1020710473 7:11598471-11598493 GCACAGATGGAGGTTATGGATGG + Intronic
1020977021 7:15018967-15018989 GGTGGGATGGAAGTCAGGCAGGG + Intergenic
1021050863 7:15982416-15982438 GCAGGGATGGAGGTCATGCATGG - Intergenic
1021988935 7:26123765-26123787 GCAGGGATGGAGGTTAAGCATGG + Intergenic
1022079008 7:27001174-27001196 GCAGGGATGGAGGTTAAGCATGG + Intergenic
1022926437 7:35059630-35059652 GAATGGATGGAAGTGAGGCAGGG - Intergenic
1024032090 7:45469768-45469790 GCAGGGATGGCTGTTATGCATGG + Intergenic
1024040662 7:45550990-45551012 GCAGGGATGGAGGTTGCGCATGG + Intergenic
1024177393 7:46855108-46855130 GCAGGGATGGAAGTTATGCATGG - Intergenic
1024380971 7:48695496-48695518 GCAGGGCTGGAAATTGTTCAAGG + Intergenic
1024744332 7:52389268-52389290 GGAGGGATGGAGGTTATGCATGG + Intergenic
1024866215 7:53907188-53907210 GCAGAGATGGATGTTATGCATGG + Intergenic
1027269648 7:76512614-76512636 GCAGGGCTGGGAGCTCTGCAAGG - Intronic
1027320358 7:77006508-77006530 GCAGGGCTGGGAGCTCTGCAAGG - Intergenic
1027406937 7:77872162-77872184 GCAGGGATGGAGGTTACGCATGG - Intronic
1027685917 7:81278798-81278820 GCAGGGATGGAGGTTATGCATGG + Intergenic
1028141853 7:87282827-87282849 GCAGGGATGGAGGTTATGCATGG + Intergenic
1028237948 7:88383665-88383687 GCAGGGAGGGAGGTTACTCATGG + Intergenic
1028935135 7:96455908-96455930 GCAGGGATGGAGGTTATGCATGG + Intergenic
1029602986 7:101580694-101580716 GAAGGGGTGGAAGCTGTGCAAGG + Intergenic
1030277668 7:107737483-107737505 GCAGGGATGGAGGTTATGCATGG + Intergenic
1030368878 7:108674883-108674905 GCAGGGATGGAGGTTATGCATGG + Intergenic
1030453538 7:109744189-109744211 GTAGGAATGGAGGTTATGCTGGG - Intergenic
1030457340 7:109792202-109792224 GCAGGAATGGAGGGTATGCATGG - Intergenic
1030883162 7:114905704-114905726 GCAGGGATGGAGGTTGCACATGG - Intergenic
1031682153 7:124688191-124688213 GCAGGGATGGAGGTTACGCATGG + Intergenic
1031833126 7:126650859-126650881 GCAGGGATGGAGGTTACGCATGG + Intronic
1032152983 7:129446116-129446138 GCAGGGACGGAAGTTACGCATGG - Intronic
1032583940 7:133129392-133129414 GCAGGGATGGAAGCTATGTATGG + Intergenic
1032923365 7:136575286-136575308 GCAGGGATGGAGGTTACGCATGG - Intergenic
1033076382 7:138253890-138253912 GTAGGGATGGAGGTCATGCATGG + Intergenic
1033135490 7:138780614-138780636 GCAGGGATGGAGGTTGTGCGTGG - Intronic
1033392396 7:140940309-140940331 ACAGGGATGGAGGTTGTGCATGG + Intergenic
1033871392 7:145758404-145758426 GCAGGGAGGGCAATAATGCAGGG - Intergenic
1034169928 7:149055114-149055136 GCAGGGATGGAGGTTACGTGTGG + Intergenic
1035754939 8:2023897-2023919 GCAGGGATGGAGGCTCTGCAGGG + Intergenic
1035971516 8:4254608-4254630 GCAGGCCTGGAAGTTGTCCAGGG - Intronic
1036132678 8:6131075-6131097 ACAGAGATGGAAGGTATTCAAGG + Intergenic
1037019993 8:13958456-13958478 GCAGGGATAGAGGTTATGCATGG + Intergenic
1037364465 8:18107419-18107441 GCAGGGATGGAGGTTATGCATGG - Intergenic
1037953777 8:23037236-23037258 GCAGGGATGGAGGTTATGTATGG + Intronic
1038454334 8:27662794-27662816 GCAGGTATGGAGGTTACCCATGG - Intronic
1039292219 8:36109088-36109110 GCAGGGATGGAGGTTACGCATGG - Intergenic
1039324053 8:36465702-36465724 GCAGGGATGGAGGTTACACATGG - Intergenic
1039831473 8:41218623-41218645 ACATGGATGGAAGTCTTGCATGG + Intergenic
1040783668 8:51140516-51140538 GCAGGGGTGGAGGCCATGCAGGG - Intergenic
1040912062 8:52529259-52529281 GCAGGGATGGAGGTTACACATGG + Intergenic
1041152843 8:54954423-54954445 GCAGAGATGGAAGTTGTATATGG - Intergenic
1041840703 8:62267079-62267101 GCAATGATGGATGTGATGCAGGG - Intronic
1042000940 8:64123151-64123173 ACAGGGATGGAGGTTATGCGTGG - Intergenic
1043258044 8:78159662-78159684 GCAGGGATGGAGGTTACAAATGG + Intergenic
1044051549 8:87512136-87512158 GCAAGGATGGAAGTTATTTTGGG - Intronic
1044150916 8:88773914-88773936 GCAGGGATGGAGGTTACACATGG + Intergenic
1044202508 8:89453331-89453353 GCAGGGATGGAGGTTATGCATGG + Intergenic
1044285855 8:90411602-90411624 GCAGGGATGGAGATTACGCATGG - Intergenic
1044487037 8:92766340-92766362 GCAGGGATGGAGTTTATGCATGG - Intergenic
1044633028 8:94297559-94297581 GCAGGGATGGAGGTTACACATGG - Intergenic
1044895949 8:96891474-96891496 GCAGAGATGGAGGTTACACATGG - Intronic
1045618572 8:103947659-103947681 GCAGGACTGGAAGTTGTTCAGGG + Intronic
1046063887 8:109174390-109174412 ACAGGGATGGAAGTTATGCATGG - Intergenic
1046128552 8:109940753-109940775 GCAGGGATGGAGGTTACCCATGG - Intergenic
1046197676 8:110885066-110885088 GCAGGGTTTGAGGTTATGCATGG + Intergenic
1046417527 8:113936950-113936972 GTAGGGATGGAGGTTACACATGG - Intergenic
1046585668 8:116146895-116146917 GCAGGGATGGAGGTTAAGCATGG - Intergenic
1047453738 8:124990154-124990176 GCAGGGATAGTGTTTATGCATGG + Intergenic
1047833742 8:128664588-128664610 TCAGGGATGAAATTTCTGCAAGG - Intergenic
1048943259 8:139421183-139421205 GCAGGGATGGGAATTACGCACGG + Intergenic
1049644207 8:143728808-143728830 GCAGGGATGTGAGGTCTGCAAGG + Intronic
1049889803 9:58227-58249 GCAGGGATGAAGGCTATGCATGG + Intergenic
1050045022 9:1533973-1533995 GCAAGGATGGAGGTCATGCATGG + Intergenic
1050124548 9:2343147-2343169 GCAGGAATGGAAGCTTTGTATGG + Intergenic
1050482796 9:6103445-6103467 GCAGGGAAGGAGATTATGCATGG + Intergenic
1050636417 9:7617516-7617538 GGAGGAATGGAGGTTATACATGG + Intergenic
1051702756 9:19841905-19841927 GCAGGGATGGAGGCTAAGCATGG + Intergenic
1051882173 9:21850885-21850907 GCAAGGATGGAGGCCATGCACGG - Intronic
1052227702 9:26109215-26109237 GCTGGGATGGAGGTTATGCGTGG + Intronic
1052442146 9:28511446-28511468 GCAGGGATGGAGGTTATACATGG - Intronic
1052497524 9:29246368-29246390 GCAAGGATGGAGGTTATGCACGG + Intergenic
1053588748 9:39488242-39488264 ACACAGATGGAAGTTATGAAGGG - Intergenic
1053695841 9:40638661-40638683 GCAGGGATGGAGGTTATGCATGG - Intergenic
1053731284 9:41059502-41059524 GCAGGGATGAAGGCTATGCATGG + Intergenic
1053942828 9:43269698-43269720 GCAGGGATGGAGGCTATGCATGG - Intergenic
1054307088 9:63437879-63437901 GCAGGGATGGAGGTTATGCATGG - Intergenic
1054405819 9:64761870-64761892 GCAGGGATGGAGGTTATGCATGG - Intergenic
1054439446 9:65247357-65247379 GCAGGGATGGAGGTTATGCATGG - Intergenic
1054490961 9:65774582-65774604 GCAGGGATGGAGGTTATGCATGG + Intergenic
1054577557 9:66877052-66877074 ACACAGATGGAAGTTATGAAGGG + Intronic
1054697225 9:68372587-68372609 GCAGGGGTGAAGGCTATGCATGG - Intronic
1054727225 9:68664765-68664787 GCAGGGATGGAGGTTACCCATGG + Intergenic
1055903819 9:81270350-81270372 ACAGGGATGGAGGTTATGCATGG - Intergenic
1056042000 9:82677888-82677910 GCAGACATAGAGGTTATGCATGG + Intergenic
1056045516 9:82711539-82711561 ACAGGGATGGAAGCCATGCATGG - Intergenic
1056314113 9:85372102-85372124 GCAGGGGTGGAGGTTATGCATGG - Intergenic
1056328981 9:85505980-85506002 GCAGGAATGGCAGGTATTCAGGG + Intergenic
1056525971 9:87443351-87443373 GCAGAGATGGAGGTTATGTATGG - Intergenic
1056808243 9:89744943-89744965 GCTGGGCTGGAAGCTCTGCAAGG + Intergenic
1057004829 9:91547957-91547979 GCAGGGATGGAAGTTATGCATGG - Intergenic
1057100472 9:92354397-92354419 GCAGGGATGGAGGTTACGCATGG - Intronic
1057663970 9:97028780-97028802 GCAAGAATAGAGGTTATGCATGG + Intergenic
1058020024 9:100076904-100076926 GCAGGGATGGAGGTTACCCATGG + Intronic
1058259142 9:102808843-102808865 GCAGGGATGGAGGTTATGTACGG - Intergenic
1058544057 9:106041911-106041933 TCAAGGATGGAGGTTATGCATGG - Intergenic
1059196383 9:112375019-112375041 GCAGGGATGGAGGTTATTCATGG - Intergenic
1059219356 9:112598400-112598422 TCAGGGAAGGAATTTAAGCAGGG + Intronic
1060178907 9:121518141-121518163 GCACTGATGGAGGTTATCCATGG + Intergenic
1060321488 9:122565451-122565473 GCAGGGATGGAGGTTATGTATGG + Intergenic
1060805016 9:126569867-126569889 GCAGTGATGGAAGTTACGCATGG - Intergenic
1062135599 9:134925851-134925873 GCAGGGATGGAGGTTACACATGG + Intergenic
1202778286 9_KI270717v1_random:12273-12295 GCAGGGATGGAGGTTATGCATGG - Intergenic
1186162711 X:6794425-6794447 GCAGGACTGGAAGTTATTCTGGG + Intergenic
1186279626 X:7977960-7977982 GCAGGGATGGAGGTTACCCATGG + Intergenic
1186383977 X:9090934-9090956 GCAGGGATGAAGGTTACACATGG - Intronic
1186469647 X:9811293-9811315 GCAGGGACGGAGGTTACACATGG - Intronic
1186825797 X:13339075-13339097 GCAGGGATGGAAGTGGCCCAAGG + Intergenic
1187524039 X:20037969-20037991 GCAGGGATAGAGGTTACACATGG + Intronic
1187568575 X:20477559-20477581 GCAAGGATGCAAGCTAGGCAAGG - Intergenic
1187642889 X:21314071-21314093 GCAGAAATGGAGGTTATGGATGG + Intergenic
1188655250 X:32686214-32686236 GCAGGGATTAAAATTAGGCATGG + Intronic
1189964093 X:46353949-46353971 CCAGAGATGGAGTTTATGCATGG - Intergenic
1190601405 X:52096694-52096716 GCAGGGATGATGGTTCTGCATGG - Intergenic
1190625241 X:52331031-52331053 GCAGGGATGCAGGTTATGCACGG - Intergenic
1190721513 X:53152776-53152798 CCAGGGATGGAGGTTATGCATGG - Intergenic
1190725394 X:53187109-53187131 GCAGGCATGGAGGTTATGCATGG + Intergenic
1190996633 X:55616645-55616667 GCAGGGATGGAGGTTACGCATGG - Intergenic
1191095597 X:56670347-56670369 GCAGAGATGGAGGTTACACATGG - Intergenic
1191629907 X:63311742-63311764 GCAGGGATGGAGGTTACACATGG - Intergenic
1191658678 X:63628966-63628988 GCAGGGATAGAGGTCATGCATGG - Intergenic
1191719124 X:64214870-64214892 CCAAGGATGGAGGTTATGCACGG - Intergenic
1191759471 X:64630752-64630774 GCAGGCGTGGAGGTTATACATGG + Intergenic
1191769382 X:64739256-64739278 GCAGAGATGGAGGTTATGCATGG - Intergenic
1191941145 X:66483036-66483058 GCAGGGATGGAGGTTACGCATGG - Intergenic
1192059256 X:67806698-67806720 GCAGAGATGGACGTCATGCATGG - Intergenic
1192297594 X:69867186-69867208 GCAGGGATGGAGGTTATGCATGG - Intronic
1192661459 X:73046941-73046963 ACAGGGATGGAGGTTACACATGG - Intergenic
1192898826 X:75472748-75472770 GCAAGGATGGAGGTTATGCATGG + Intronic
1192996296 X:76516418-76516440 GTAGGGATGGAGATTATGCAAGG + Intergenic
1193009328 X:76658382-76658404 GCAGGGATGGATGTTATTGATGG - Intergenic
1193053611 X:77126609-77126631 GCAGGAATGGAAGTTATGCATGG + Intergenic
1193187476 X:78530047-78530069 GAAGGGATGGAGGTTATACCTGG + Intergenic
1193288038 X:79737069-79737091 GTAGTGATGGAAGTTATGCATGG + Intergenic
1193297893 X:79853498-79853520 GCAAGGATGGAGGTTATGCATGG + Intergenic
1193356366 X:80523970-80523992 GCAGGGATGGAGGTTTCACATGG + Intergenic
1193447277 X:81619604-81619626 GCATGGATGGAAGTTCCACATGG + Intergenic
1193573593 X:83174333-83174355 GCAGGAATGGAGGTTATGCATGG - Intergenic
1193833069 X:86310948-86310970 GCAGGGATGGAGGTTATGCATGG + Intronic
1193957409 X:87879059-87879081 GCAGGGATGGAGGTTACGCATGG + Intergenic
1194140714 X:90205332-90205354 GCTGAGATGGAGGTTATGCCTGG - Intergenic
1194163839 X:90489316-90489338 GCAGAGATGGAGTTTCTGCATGG - Intergenic
1194174737 X:90631676-90631698 GCAGGGATGGAGGTTATACATGG + Intergenic
1194210390 X:91063192-91063214 GCAGGGATGGAGGTTACACATGG + Intergenic
1194343429 X:92731927-92731949 GCAGGGATGGAGGTTATGCATGG + Intergenic
1194443654 X:93961944-93961966 GCAGGGATGGAGGTTATGCATGG + Intergenic
1194453994 X:94079999-94080021 GCAGGGATGGAGGTTACACATGG - Intergenic
1194485223 X:94478167-94478189 GCAGGGATGGAGATTATGCATGG + Intergenic
1194604259 X:95961011-95961033 GCAGGGATGGAGGTTACACATGG - Intergenic
1194834067 X:98659641-98659663 GCAGGGATGGAGGTTATGCATGG + Intergenic
1195262770 X:103149823-103149845 GCAGGGATGGACTTTATGCTTGG + Intergenic
1195748402 X:108141229-108141251 GCAGGGATAGAGGTTACACATGG - Intronic
1195748811 X:108144520-108144542 GCAGGGATGGAGGTTACACACGG - Intronic
1195751014 X:108162007-108162029 GCAACAATGGAAATTATGCAGGG + Intronic
1195782230 X:108479033-108479055 GCAGGGGTGGAGGTTATGCATGG - Intronic
1195783911 X:108495813-108495835 GCAGGGATGGAAATTATGCATGG + Intronic
1195809672 X:108816007-108816029 GCAGGGATGGAGGTTACACATGG - Intergenic
1196135847 X:112209000-112209022 GCAGGGATGGAGGTTAAGCATGG - Intergenic
1196151410 X:112378738-112378760 GCAGGAATGAAGGCTATGCACGG + Intergenic
1197002410 X:121453757-121453779 GCAGAGATGGAGGTTATGCATGG + Intergenic
1197044535 X:121979150-121979172 GCAGGGATGGAGGTTACACACGG + Intergenic
1197084090 X:122452661-122452683 GCAGGGATGGAGTTTACCCATGG - Intergenic
1197182215 X:123548623-123548645 ACAGGGATGGAGGTTACGCATGG + Intergenic
1197244929 X:124158160-124158182 GCAGGGATGGAGGTTACACATGG - Intronic
1197371937 X:125637024-125637046 GCAGGGATGCAGGTCATGCATGG - Intergenic
1197379886 X:125727049-125727071 GCAGGGATGGAGGTTATGCATGG - Intergenic
1197386660 X:125811401-125811423 GCAGGGATGGAGGTTACACATGG - Intergenic
1197405163 X:126039783-126039805 GCAGGGATGGAGGTTATGCATGG + Intergenic
1197409210 X:126095603-126095625 GCAGGGATGGAGGTTACACATGG - Intergenic
1197419998 X:126227173-126227195 GCAGGGATGGAGGTTACGCATGG + Intergenic
1197477246 X:126940590-126940612 GCAGGGATGGAGGTTACCTATGG - Intergenic
1197591993 X:128420227-128420249 GCAGGGATGGAGGTTATGCATGG + Intergenic
1197765231 X:130055823-130055845 GCAAGGATGGGAGTTATTGAAGG - Intronic
1197988885 X:132295902-132295924 GCAGGAATGGAGGTTATGCATGG - Intergenic
1198066956 X:133107645-133107667 ACAGGGATGGATGCTATGGATGG + Intergenic
1198170119 X:134097082-134097104 ACAGGGATGGAGGTTATGCATGG + Intergenic
1198701422 X:139401139-139401161 GCAGGGATGGAGGTTACGCATGG + Intergenic
1198782919 X:140256969-140256991 GCAGGGATGGAGGTTATGCATGG - Intergenic
1198934158 X:141888698-141888720 GCATGGATGGAGGTTATGCATGG + Intronic
1199013203 X:142781113-142781135 TCAGGGATGGACATCATGCATGG + Intergenic
1199144343 X:144348135-144348157 GCAAGGATGCAGGTTATGTATGG - Intergenic
1199310308 X:146313560-146313582 GCAGGGATGGAGGTTATGCATGG - Intergenic
1199878313 X:151953008-151953030 GCAGGTCTGGAAATTATGGATGG + Intergenic
1200134660 X:153869052-153869074 GCAGGGAAGCAAGATTTGCAGGG - Intronic
1200289506 X:154858245-154858267 GCAGGGATAGAGGCTATGCATGG + Intronic
1200304064 X:155007348-155007370 GCAGGGAGAGAATTAATGCATGG + Intronic
1200340360 X:155389800-155389822 CCAGGGATGGAGGTTACACATGG - Intergenic
1200486480 Y:3774459-3774481 GCTGAGATGGAGGTTATGCCTGG - Intergenic
1200510102 Y:4067125-4067147 GCAGAGATGGAGTTTCTGCATGG - Intergenic
1200521383 Y:4212865-4212887 GCAGGGATGGAGGTTATACATGG + Intergenic
1200651783 Y:5848592-5848614 GCAGGGATGGAGGTTATGCATGG + Intergenic
1200745937 Y:6904029-6904051 GCAGGTATGGAGGTTATGCAGGG - Intergenic
1200976718 Y:9219277-9219299 GCAGGGATGGAAGTTATGCATGG + Intergenic
1201193601 Y:11470577-11470599 GCAGGGATGGAGGCTATGCATGG - Intergenic
1201529545 Y:14977067-14977089 GCAGGGATGGAGGTTATGCATGG - Intergenic
1201798520 Y:17927509-17927531 GCAGGGGTGAAGATTATGCACGG + Intergenic
1201803033 Y:17978448-17978470 GCAGGGGTGAAGATTATGCACGG - Intergenic
1202039715 Y:20668956-20668978 GCAGGGATAGAAGATATTGATGG - Intergenic
1202138057 Y:21687635-21687657 GCAGGAATGGAGGTTACACATGG + Intergenic
1202359840 Y:24096199-24096221 GCAGGGGTGAAGATTATGCATGG + Intergenic
1202510938 Y:25573915-25573937 GCAGGGGTGAAGATTATGCATGG - Intergenic