ID: 996825685

View in Genome Browser
Species Human (GRCh38)
Location 5:127678672-127678694
Sequence CAGGGATGGAAGTTATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 9, 1: 96, 2: 194, 3: 236, 4: 349}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996825675_996825685 21 Left 996825675 5:127678628-127678650 CCTGTCATCACTGAATGGGCCCA No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825673_996825685 23 Left 996825673 5:127678626-127678648 CCCCTGTCATCACTGAATGGGCC No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825674_996825685 22 Left 996825674 5:127678627-127678649 CCCTGTCATCACTGAATGGGCCC No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825670_996825685 26 Left 996825670 5:127678623-127678645 CCACCCCTGTCATCACTGAATGG No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825669_996825685 30 Left 996825669 5:127678619-127678641 CCAGCCACCCCTGTCATCACTGA No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825677_996825685 2 Left 996825677 5:127678647-127678669 CCCATGAACAAAGTCGCCATGGT No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349
996825678_996825685 1 Left 996825678 5:127678648-127678670 CCATGAACAAAGTCGCCATGGTG No data
Right 996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG 0: 9
1: 96
2: 194
3: 236
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996825685 Original CRISPR CAGGGATGGAAGTTATGCAT GGG Intergenic
901444820 1:9301694-9301716 CAGAGATGGAGGTGATGCATGGG + Intronic
901903794 1:12390804-12390826 CAGGGATGGAGGTTATGCATGGG - Intronic
902619533 1:17642827-17642849 TCAGGATGGAAGTGATGCATGGG - Intronic
903273456 1:22206508-22206530 ATGGGATGGAAGTTATGGATCGG - Intergenic
904040336 1:27580573-27580595 CAGGGTTGGAAGTTAAGCCTGGG - Intronic
904269059 1:29337222-29337244 CAGGGATGGAAGATATGCCTGGG + Intergenic
904708066 1:32406789-32406811 CAGGAGTGGAAATTATGCATAGG - Intergenic
905354199 1:37369654-37369676 CAGGGATGGAGGTTACACATGGG + Intergenic
905465354 1:38148975-38148997 CAGGGATGGAGGTTATTCATGGG + Intergenic
905466561 1:38158711-38158733 CAGGGATGGAGGATCTGCATAGG + Intergenic
906054815 1:42907279-42907301 CAGGGAGGGAGGTTATGTGTAGG - Intergenic
906258923 1:44371488-44371510 GATGGAAGGAAGTTATGCATGGG + Intergenic
906748650 1:48239507-48239529 CAGGGATGGGAGTTGTACAGAGG - Exonic
906867878 1:49441894-49441916 CAGGGATGGAGGTTACGCATGGG + Intronic
906879782 1:49577326-49577348 CAAGGATGGAGGTTACACATGGG + Intronic
906930799 1:50167653-50167675 CAGGGATGGAGGTTATGCATAGG - Intronic
907597475 1:55732992-55733014 TAGGGATGGAGGTTATGCATGGG + Intergenic
907780465 1:57561707-57561729 CTGGGATGGAGGTTACGCATGGG + Intronic
908052436 1:60247583-60247605 CAGGAATGGAGGTTATGCATGGG + Intergenic
908737512 1:67291685-67291707 CAGGGATGGAGGTTTCGCATGGG + Intergenic
909172479 1:72314593-72314615 CAGGGATGGAGGTTATGCATGGG - Intergenic
909278840 1:73722973-73722995 CAAGAATGGAGGTTATGCATGGG + Intergenic
909548827 1:76876326-76876348 CAGGGATGGAGGTTACACATGGG - Intronic
909811069 1:79932202-79932224 CAGGGATGAAGGTTATGCATGGG + Intergenic
910010281 1:82452897-82452919 CAGAGATGGAGGTTATGTATGGG + Intergenic
910349668 1:86281108-86281130 CAGGGATGGAGGTTGTGTTTGGG + Intergenic
910370762 1:86513003-86513025 CAGGGATGGAGGTTACTCATGGG + Intergenic
910562018 1:88600841-88600863 CAGGGATGGAAGTTAGACACGGG + Intergenic
910565436 1:88637986-88638008 CAGGGATGGAGCGTATGCATGGG - Intergenic
910565569 1:88639194-88639216 CAAGGATGGAGGGTATGCATGGG - Intergenic
910588343 1:88902592-88902614 CAGGAATGGAGGTTACGGATGGG + Intergenic
910630339 1:89347136-89347158 CAGGGGTGGAAGTTATGCATGGG + Intergenic
910638861 1:89439102-89439124 CAGGGATGGAGGTTACGCATGGG - Intergenic
910708839 1:90157718-90157740 GAGGGAGGGAAGATATGAATCGG - Intergenic
910790456 1:91044615-91044637 CAGGGATGGAGATTATACATGGG + Intergenic
911109045 1:94163832-94163854 CAGGGATGGAGGTTACGCATGGG - Intronic
911460764 1:98187224-98187246 CAGGGAAGGAAGTAATGCTCTGG - Intergenic
911498453 1:98658601-98658623 CAGGGATTTATGCTATGCATTGG + Intergenic
911883695 1:103271334-103271356 CAGGGATGGAAGTTATGCATGGG + Intergenic
911980543 1:104560295-104560317 CAGGGATGGAGGTTATGCATGGG + Intergenic
912129788 1:106587185-106587207 CAGGGATGGAGGTTACGCATGGG - Intergenic
912212373 1:107569728-107569750 CAGGGTTGGAGGTTACACATGGG + Intergenic
912251899 1:108020515-108020537 GAGGGATGGAGGTTACGCATGGG - Intergenic
912405765 1:109436303-109436325 CAGGGATAGAGGCTATGTATGGG + Intergenic
912491881 1:110066963-110066985 CAGGCATGGGAGTTGGGCATAGG - Intronic
912708116 1:111929822-111929844 GAGGGATGGCAGTTATGAACGGG + Intronic
912733203 1:112127961-112127983 CGGGGATGGAGGTTATGCATGGG - Intergenic
912943683 1:114067334-114067356 CAGGGATGGAGGTTACACATGGG - Intergenic
915210489 1:154305190-154305212 TAGAGATGGAGGTGATGCATGGG - Intergenic
915667555 1:157458801-157458823 CAGGGATGGAGGTCATGCATGGG - Intergenic
916106071 1:161433426-161433448 CAGGGATGGAGGTTACACATGGG - Intergenic
916285454 1:163100392-163100414 CAGGAATGGAGGTTATGCAGGGG + Intergenic
916381002 1:164210417-164210439 CAAGAATGGAAGTCATTCATGGG + Intergenic
917052389 1:170938938-170938960 CAGGGATGTAAATTATGTATGGG - Intronic
917103611 1:171470319-171470341 CAGTCCTGGAAGTTATGAATGGG - Intergenic
917217094 1:172690035-172690057 CAGGGATGGAAGTTACGCATGGG - Intergenic
917673022 1:177291978-177292000 CAAGGATGGAGGCTATGAATGGG - Intergenic
917764661 1:178202883-178202905 CAGGGGTGGAGGTTATGCATGGG + Intronic
918014767 1:180622788-180622810 CAGAGATGGAAGATATGCAGGGG - Intergenic
918051939 1:180981247-180981269 TAGTCAGGGAAGTTATGCATGGG + Intronic
918755586 1:188336941-188336963 CAGGGATGGAGGTTATGCATGGG - Intergenic
918774621 1:188611619-188611641 CAGGGATGGAGGTTACCCATGGG + Intergenic
918783348 1:188731695-188731717 CAGGGATGAAAGTTACACATGGG - Intergenic
918815181 1:189172094-189172116 CAGGGATGGAGATTACACATGGG + Intergenic
918918114 1:190671013-190671035 CAGGGATGGAGGTTACGCATAGG - Intergenic
918958358 1:191238805-191238827 CAGGGATGGAGGTTACACATTGG + Intergenic
919124252 1:193377095-193377117 GTGGGAAGGAGGTTATGCATGGG - Intergenic
919241888 1:194925077-194925099 CAGTGATGGAGGTTATGCATGGG + Intergenic
919318093 1:196000202-196000224 CAGGGATGGAGGTTACGCATAGG + Intergenic
919330326 1:196162799-196162821 CAGGGATGGAGGTTACGCATGGG + Intergenic
921619909 1:217313983-217314005 CAGGAATGGAAATTATATATGGG + Intergenic
921720912 1:218470003-218470025 AAAGGGTAGAAGTTATGCATGGG + Intergenic
921911383 1:220552961-220552983 CAGGGATGAAGGTTATGCATGGG - Intronic
921986449 1:221317769-221317791 CAAGGATGGAGGTTATGCATAGG + Intergenic
923926075 1:238628946-238628968 CAGGGATGGAGGATTTGCATGGG - Intergenic
924679626 1:246219164-246219186 CAGGGATGTAAGTTCTACTTTGG - Intronic
924824888 1:247529014-247529036 CAGGGATGGAAACTATGAATGGG + Intronic
924840648 1:247706958-247706980 CAGGGATGGAGGTTACACATGGG - Intergenic
924847019 1:247784272-247784294 CAGGGATGAAAGTTATGCATGGG - Intergenic
924880782 1:248159870-248159892 CATGGATGAAAGCTATGCCTGGG - Intergenic
1063131733 10:3184236-3184258 CAGTGAAGGCAGTAATGCATTGG + Intergenic
1063788243 10:9409377-9409399 CAGGGATGGAGGTTATGCATGGG + Intergenic
1065016588 10:21468077-21468099 CAGGGACTGAAGTCATGTATAGG - Intergenic
1065661211 10:28005750-28005772 CAGGGATGGAGGCTATGCATGGG + Intergenic
1066003706 10:31128210-31128232 CAGGTATGGAAGCTATGCATGGG - Intergenic
1066166900 10:32798356-32798378 CAGGGATGGAGGTTACGCATGGG - Intronic
1066169560 10:32827193-32827215 CAGGGATGGAGGTTATACATGGG + Intronic
1066748773 10:38631310-38631332 CAAGGATGGAGGCTATGCAGAGG + Intergenic
1066967893 10:42286476-42286498 CAAGGATGGAGGCTATGCAGAGG - Intergenic
1067333267 10:45341091-45341113 CAGGGATGGAGGTTATACATGGG + Intergenic
1067461801 10:46463671-46463693 CAATGATGGATGTTTTGCATGGG + Intronic
1067625393 10:47920930-47920952 CAATGATGGATGTTTTGCATGGG - Intergenic
1068452251 10:57206955-57206977 CAAAGATGGAAGCTATGAATGGG - Intergenic
1068740251 10:60461015-60461037 CAGGGATGCAATTTAAGCACAGG + Intronic
1068800220 10:61132104-61132126 CAGGAATGGAAGTTTTGGGTAGG + Intergenic
1068837090 10:61567509-61567531 CAGGGAGGGAGGTTATGCCTGGG - Intergenic
1069192183 10:65505498-65505520 CAGGGATGGAGGTTACACATGGG - Intergenic
1069790706 10:71018712-71018734 CAGGGATGGAGGTTATGCATGGG - Intergenic
1071028821 10:81147200-81147222 CAGGGATGGAAAATAGGCAGTGG - Intergenic
1071266953 10:83973132-83973154 CAGGGATGGAGGTTACACATGGG - Intergenic
1071308634 10:84322924-84322946 CAGGGATGGAGGTTATGAATGGG + Intergenic
1071378502 10:85034231-85034253 CAGGGATGAAGGTTATGCATGGG + Intergenic
1071487575 10:86112871-86112893 GAGGGATGCATGTTTTGCATTGG + Intronic
1071673792 10:87636554-87636576 AATGGATGGAGGTTATGCATGGG - Intergenic
1071920135 10:90340466-90340488 CAGGGATGGTAGCTCTTCATGGG + Intergenic
1071937814 10:90550150-90550172 CGGGGATGGAGGTTATCCATGGG + Intergenic
1071942660 10:90606902-90606924 CAGGGATGGAGGTTATGCCTGGG - Intergenic
1071950705 10:90700204-90700226 CTGGGAAGGAGGTTATACATGGG - Intergenic
1072361962 10:94668396-94668418 CAGGGACAGAGGTTATGCACGGG - Intergenic
1073656557 10:105423620-105423642 CAGGGATGGAGGTTATCCATGGG - Intergenic
1073830401 10:107377136-107377158 CAGGGATGAAGGTAATGCATGGG - Intergenic
1073995751 10:109313864-109313886 CAGGGATGGAGGTTATTCTTGGG - Intergenic
1074235541 10:111581239-111581261 CATAGATGGAGGTTATACATGGG - Intergenic
1074536626 10:114332580-114332602 CAGGCTTGGAAGTTAGGAATTGG + Intronic
1074632407 10:115273198-115273220 CAGGGATGGAGATTATGCATGGG - Intronic
1075606915 10:123818277-123818299 CAGGGATGGAGGTTACGCATGGG + Intronic
1076123405 10:127954188-127954210 CAGGGATGGAGGCTGTTCATGGG + Intronic
1076271441 10:129155694-129155716 CAGGGATGGAAGCTATGCATGGG + Intergenic
1076522602 10:131090444-131090466 CAGGGATGCAGGGTCTGCATGGG - Intergenic
1076927279 10:133498344-133498366 CAGGGATGGAGGTTATGAATGGG - Intergenic
1077389710 11:2294596-2294618 CAGGGATGGAGGTCACACATGGG - Intergenic
1077401375 11:2359634-2359656 CAGGGATGGAGGTTGTGCGTGGG + Intergenic
1080076719 11:28158363-28158385 CAGGGATGGAGTTTATGCATGGG + Intronic
1080100368 11:28452732-28452754 CAGTGATGGAGGCTATGCATAGG - Intergenic
1080834266 11:35925989-35926011 CAGAGATGGTATTTATCCATTGG + Intergenic
1081072912 11:38632043-38632065 CAGGGATGGAGGTTACACATAGG + Intergenic
1081110648 11:39129583-39129605 CAGGGATGGAGGTTATGCATGGG + Intergenic
1081378408 11:42386775-42386797 CAGAGATGGAGGTTACGCGTGGG + Intergenic
1081520352 11:43875548-43875570 CAGGGATGGAGGATATGCATGGG - Intergenic
1081609185 11:44548726-44548748 CAGGGCTGGAGGTTACGCATGGG + Intergenic
1082671813 11:56043890-56043912 CAGGGATGGAGGTTACACATGGG + Intergenic
1082999782 11:59280711-59280733 TAGGGATGGAGGTTACCCATGGG + Intergenic
1083093260 11:60221974-60221996 CAGGGATGGAGGATATGCATGGG + Intronic
1083689927 11:64401309-64401331 CAGAGATGGAGGTTATGCAGGGG + Intergenic
1083961722 11:66018372-66018394 CAGGAATGGAGGTTGAGCATCGG + Intronic
1084571579 11:69962953-69962975 CAGGGATGGAAGGTGTCCCTGGG - Intergenic
1085616101 11:78000158-78000180 CAGGGATAGAGGCTATTCATGGG - Intergenic
1085684788 11:78611714-78611736 CAGGGATGGAGGTTATGCACGGG + Intergenic
1085686079 11:78623034-78623056 CAGGGATGGAGATTACGCATGGG + Intergenic
1086141510 11:83505355-83505377 CAGGGATGGAGATTATGCATGGG - Intronic
1086278729 11:85161296-85161318 TAGGGTTGGAGGTTATACATGGG + Intronic
1086399835 11:86451491-86451513 TAAGGATGGAGGCTATGCATGGG + Intronic
1086676354 11:89611792-89611814 GAGGGAGGGAAGGTATGCATAGG - Intergenic
1086834244 11:91601232-91601254 CAGGCATGGAGGTTACACATGGG + Intergenic
1087021501 11:93607905-93607927 CAAGGATAGAGGTTGTGCATGGG - Intergenic
1087180633 11:95138544-95138566 CACGGTTGTAAGTTATGCAGAGG + Intergenic
1088097336 11:106116002-106116024 CAGGGATGGACGTTACACATGGG + Intergenic
1088106080 11:106208368-106208390 CAGAGATGGAAATTATGCATAGG - Intergenic
1088191530 11:107233648-107233670 CAGAGATGGAGGTTACACATGGG - Intergenic
1088308408 11:108434518-108434540 AAGGAATGGAGGTTATTCATAGG + Intronic
1088407492 11:109497817-109497839 CAGAGATGGAGGTTACACATGGG - Intergenic
1088449471 11:109966200-109966222 CAGGGACAGAGGTTATGCATGGG + Intergenic
1088836782 11:113584228-113584250 CAGGGATGGAGGTTACGCATGGG + Intergenic
1089806430 11:121094678-121094700 CAGGGTTGGAGGTTATGCATGGG - Intergenic
1089851045 11:121496796-121496818 GAGGCATGGAAGTTTTGCAATGG - Intronic
1089903738 11:122014460-122014482 CAGGGATGAAAGTTACACATGGG + Intergenic
1090119073 11:124005547-124005569 CAGGGATGGAGGTTACGAATGGG - Intergenic
1090209367 11:124907209-124907231 CAGGGATGGAGGTTACGCATGGG - Intergenic
1090221486 11:125030754-125030776 CAGGGATGGAGGTTACGCATGGG - Intronic
1090575233 11:128095047-128095069 CAAGGATGGAAGTTACGCATGGG + Intergenic
1091103589 11:132898063-132898085 TAGGGATGGAGGTTGTGCACGGG + Intronic
1092093405 12:5822482-5822504 CAGGGATGGAGGTTACACATGGG + Intronic
1092272519 12:7034539-7034561 CCAGGATGGACATTATGCATGGG + Intronic
1092381670 12:8001771-8001793 CAGGGATGGAGATTACGCATGGG + Intergenic
1092664241 12:10777093-10777115 CAGGGATGGAAGTGACAGATTGG + Intergenic
1093031742 12:14295087-14295109 CAGGGATGGAGGTTATACATGGG - Intergenic
1093036467 12:14336523-14336545 CAGGGATGGAGGTTGCACATGGG + Intergenic
1093048817 12:14484228-14484250 CAGTGATGGAGGTGATGCCTGGG - Intronic
1093349395 12:18079423-18079445 CAGAGATGGAAGCAATGCATGGG + Intergenic
1093645837 12:21584518-21584540 CAGGGATGGAAGTTATGCTTGGG + Intronic
1093964662 12:25311799-25311821 CAGGGATGGAGGTTACACATGGG + Intergenic
1093981486 12:25479950-25479972 CAGGGATGGAGGTTATGCATGGG - Intronic
1094102654 12:26780110-26780132 CAGGGATAGAGGTTACTCATGGG + Intronic
1094389669 12:29935375-29935397 CAGGGATGGAGGATACGCATGGG - Intergenic
1095121388 12:38423991-38424013 CAGGGATGGAGGTTATGCATGGG - Intergenic
1095190374 12:39251009-39251031 CAGGGATGATGGTTATGCATGGG + Intergenic
1095603975 12:44045183-44045205 CAGGGATGGAGGTTACACATGGG + Intronic
1095738625 12:45584974-45584996 CAGGGATGGGGGTTACACATGGG + Intergenic
1095775282 12:46003517-46003539 CAGAGATGGAGGTTATACATGGG - Intergenic
1095856131 12:46862828-46862850 CAGGGATGGAGCTTACACATGGG - Intergenic
1096288895 12:50324098-50324120 CAGGACTGGAGGTTATGCGTGGG + Intergenic
1096457338 12:51798600-51798622 CAGGGATGGAGGTTACGCATGGG - Intronic
1096674980 12:53221506-53221528 AAGGGAGGGCAGTTATGCCTAGG - Intronic
1096735092 12:53646974-53646996 CAGGAATGGAACTTATGCATGGG + Intronic
1097077120 12:56403247-56403269 CAGGGATGGAGGTTACACATGGG + Intergenic
1097437709 12:59571408-59571430 TGGGGGTGGAAGTTATGCATGGG - Intergenic
1097554712 12:61122450-61122472 CAGAGATGGAGGTTACACATGGG + Intergenic
1097564527 12:61251600-61251622 TGGGGGTGGAAGTTATGCATGGG - Intergenic
1097821228 12:64131060-64131082 CAGGGATGGAGGTTACTCATGGG - Intronic
1097843225 12:64341904-64341926 CAGGGATGGAGGTTATGCATGGG - Intronic
1098031375 12:66258186-66258208 CAGGGATGAAAGTTATGTGTGGG - Intergenic
1098673142 12:73255092-73255114 CAGGAATGGAGGTTACTCATTGG + Intergenic
1098714498 12:73812753-73812775 CACAGATGGAGGTTATGCATGGG + Intergenic
1098731175 12:74038184-74038206 CAGGGATGGAGGTTACACATGGG + Intergenic
1098733414 12:74066479-74066501 CAGGGATGGAGGTTATGGATGGG + Intergenic
1098745797 12:74235431-74235453 CAGGGATGGAAGCTAAGCAGGGG + Intergenic
1098831789 12:75373184-75373206 CAGGGATGAAGGTTACACATGGG - Intronic
1099183266 12:79491756-79491778 CAGTGATGGAGGTTATGCATAGG - Intergenic
1099366052 12:81766228-81766250 TAGGGATGGAGGTTATGCATGGG + Intergenic
1099379268 12:81935704-81935726 CAGGGATGGAGGTTATGCATGGG - Intergenic
1099401087 12:82204519-82204541 CAGGCATGAAGGTTATGCATGGG - Intergenic
1099490554 12:83283404-83283426 CAGGGATGGACGTTACTTATGGG - Intergenic
1099508690 12:83508032-83508054 CAGGGATGGAGGTTATGGATGGG + Intergenic
1099526482 12:83723941-83723963 CAAGGATGGAGCTTATGCATGGG + Intergenic
1099700766 12:86078702-86078724 CAGGGATAGAGGTTATGCATGGG - Intronic
1099804328 12:87498776-87498798 CAGCGATGGAAGTTATACATGGG - Intergenic
1099813629 12:87618417-87618439 TAGTGATGCAAGTTATGCATGGG - Intergenic
1100083425 12:90879054-90879076 CAGGGATGGAGGTTATGCATGGG + Intergenic
1100232075 12:92618757-92618779 CAGGGATGGAGGTTACACATGGG + Intergenic
1100552699 12:95660921-95660943 CAGGGCAGGAAGTTGAGCATGGG + Intronic
1100956763 12:99917391-99917413 CAGGGATGGAGGCTATGCATGGG + Intronic
1101264261 12:103066964-103066986 CAGGGATGGAGGTTTCACATGGG + Intergenic
1101534540 12:105605258-105605280 CAGGGTTGGAGGTTACACATGGG - Intergenic
1101543190 12:105683483-105683505 TAGGGATGGAGGTTACACATGGG + Intergenic
1101852532 12:108415600-108415622 CAGAGATGGAGATGATGCATGGG - Intergenic
1103035746 12:117654920-117654942 CAGGGATGGAGGTTACGCATTGG + Intronic
1103396657 12:120612296-120612318 CAGGAATGGAGGTTATGCATGGG + Intergenic
1104147918 12:126053510-126053532 CAGGGATGGAGGTTATGTATGGG + Intergenic
1105728318 13:23187104-23187126 CAGGGAGGGAGGCCATGCATGGG - Intronic
1105740238 13:23316029-23316051 CAGGGATGGAGGTTACGCATTGG + Intronic
1106046161 13:26144193-26144215 CAGGGATGGAGGTTATGCATGGG - Intronic
1106054686 13:26227384-26227406 CAGAGGTGGAGGCTATGCATGGG - Intergenic
1106091894 13:26603453-26603475 CAGGGATGGGATATAGGCATGGG + Intronic
1106161157 13:27202485-27202507 CAGGGATGGACGCTATGCATGGG + Intergenic
1106650364 13:31683830-31683852 CAGGGATGGAGATTTTACATGGG - Intergenic
1107505280 13:41027419-41027441 CAGGGATGGAGGTTATTCACGGG + Intronic
1107709012 13:43134285-43134307 AAGGCATGGAGGTTATACATTGG + Intergenic
1107983457 13:45755114-45755136 CAGAGATGGAGGTTATGCATGGG - Intergenic
1108166930 13:47702868-47702890 CAAGAATGGAGGTTATGCATGGG + Intergenic
1108904400 13:55450806-55450828 CAGGGATGGGGGTTATGCATTGG + Intergenic
1109069567 13:57747445-57747467 CACTGATGGAGGTTATGCAGGGG + Intergenic
1109218565 13:59617282-59617304 CAGGCATGGAAGGCAGGCATAGG - Intergenic
1109307246 13:60654444-60654466 CAGGGATGAAAGTTATGCCCAGG + Intergenic
1109335979 13:60994290-60994312 CTGGGATGGAAGATATGTAGGGG - Intergenic
1109392456 13:61710166-61710188 CAGGGATAGAGTTTATGCATAGG + Intergenic
1109468930 13:62779200-62779222 CTGGGATGGAAGTTTTGCTGAGG - Intergenic
1109583162 13:64367015-64367037 CAGGGATGGAGGTTATGAATGGG + Intergenic
1109950901 13:69501363-69501385 CAGGGATGGAGGTTATGCATGGG - Intergenic
1110362503 13:74643250-74643272 CAGGGAAAGAAGACATGCATGGG + Intergenic
1110377286 13:74807359-74807381 CAGGGATGGAGGTTATGCACGGG + Intergenic
1110812819 13:79829275-79829297 CAGGGCAGGATGCTATGCATGGG + Intergenic
1110815548 13:79856722-79856744 CAGGGATGGAGGTTATGCATGGG + Intergenic
1110834019 13:80063782-80063804 CAGGGATGGAGGTTACACATGGG - Intergenic
1111016336 13:82387039-82387061 CAGGGATGGAGATTATGTGTGGG - Intergenic
1111057672 13:82972177-82972199 CAGGGATGGAGGTTACACATGGG - Intergenic
1111198653 13:84905734-84905756 CAAGGATGGAGGTTACACATGGG + Intergenic
1111317619 13:86582647-86582669 CAGGGATGGAGGTTACGCATGGG + Intergenic
1111388081 13:87555906-87555928 AAGGGATAGAAGTTATTCTTTGG + Intergenic
1111498336 13:89083870-89083892 CTGGGATGGGAGTTATGCATGGG + Intergenic
1111556873 13:89892366-89892388 CAGAAATGGAAGCTCTGCATGGG - Intergenic
1111675469 13:91382454-91382476 CAGAAATGGAAGTCAAGCATAGG - Intergenic
1112057601 13:95705169-95705191 CAGGGATGGAGATTATGAATGGG - Intronic
1112249812 13:97769456-97769478 CAGGGATGGAGGTTACACATGGG - Intergenic
1112981776 13:105393778-105393800 CAGGGATGGAGGCTACGCATGGG - Intergenic
1113319577 13:109220826-109220848 CAAGGATGGAGGTTATGCATGGG - Intergenic
1114205986 14:20571615-20571637 CAGGGATGGAGGTTATGCATGGG + Intergenic
1114896247 14:26994492-26994514 CAGGAAAGGAGGTTATGCACGGG - Intergenic
1114905272 14:27119711-27119733 CAGGGATGGAGGTTACACATGGG - Intergenic
1115059829 14:29174730-29174752 CAGGGATGGAGGTTATGCATGGG + Intergenic
1115328297 14:32166627-32166649 CAGGGCTGGAGGCTATTCATGGG + Intergenic
1115829964 14:37326675-37326697 CAGGCATGGAAGTTCTGCAAGGG - Intronic
1116023140 14:39485350-39485372 CAGGGATGGAGGCTATGCCCGGG + Intergenic
1116023185 14:39485802-39485824 CAGGGATGGAGGCTATGCATGGG - Intergenic
1116059023 14:39897774-39897796 CAGGGATGGAGGTTACCCATTGG + Intergenic
1116068211 14:40010016-40010038 CAGGGCTACAGGTTATGCATGGG + Intergenic
1116116344 14:40656462-40656484 CAGGCATGAAGGTTATGAATGGG - Intergenic
1116249166 14:42458482-42458504 CAGAGATGGAGATTATGCATGGG + Intergenic
1116415184 14:44670142-44670164 CAGGGATGAAGGTTTCGCATGGG + Intergenic
1117216972 14:53561022-53561044 CAGGGATGGAGGTTATGCATGGG + Intergenic
1117780002 14:59222560-59222582 CAGGGATGGAGGTTAGGCATGGG - Intronic
1118122316 14:62859331-62859353 CAGGGATGGAGGTTATGCATGGG - Intronic
1118343464 14:64915552-64915574 CAGAAATGGAATTTGTGCATTGG + Intronic
1118385184 14:65250419-65250441 CAGAGATGAAGGTTATGCATAGG - Intergenic
1118880651 14:69823168-69823190 CAGGGATGGAGGTTACACATGGG - Intergenic
1118950632 14:70433726-70433748 CAGGGAAGGAGGTTATGTATGGG - Intergenic
1119107435 14:71937995-71938017 CAGGGATGGAGGTTATGCATGGG - Intronic
1119214868 14:72861306-72861328 CAGGAATGCAAGTTATCCAGTGG - Intronic
1120498285 14:85262736-85262758 CAGGGATGGAGGTTACGCATGGG - Intergenic
1120555869 14:85929589-85929611 GAGGGATGGAGGTTACGCATGGG - Intergenic
1120710365 14:87787301-87787323 CAGGGATGGAGGTTATGTGTGGG - Intergenic
1120919809 14:89744563-89744585 CAGGGATGGAGGTTACGCATGGG + Intergenic
1120954525 14:90069711-90069733 CATTAATGGATGTTATGCATGGG + Intronic
1121070595 14:91017066-91017088 CAGAGATGGTGGTTACGCATGGG + Intronic
1122207516 14:100155378-100155400 CAGGGATGGAAGCTGTGGGTAGG - Intronic
1122841329 14:104465209-104465231 CAGGGATGGAGGTAGTACATGGG - Intergenic
1123908387 15:24942858-24942880 CAGGGATGAAGGTTACGCATGGG - Intronic
1123978361 15:25574352-25574374 CAGGAATGGAGGCTATGCATGGG - Intergenic
1124571324 15:30866851-30866873 CAGGGATGGAGGTTATGCATGGG - Intergenic
1124647552 15:31449685-31449707 CAGGGATGGAAGCTATGCACAGG - Intergenic
1126117539 15:45222273-45222295 CAGGGTTAGAAGTTATGCATCGG - Intergenic
1126171022 15:45695372-45695394 CAGGGAGGGAAGAAATGCTTTGG + Intergenic
1126238150 15:46409718-46409740 CAGGGATGCAGGTGATGCCTGGG - Intergenic
1127039757 15:54961826-54961848 CAGGGAAGGAAATTTTCCATGGG - Intergenic
1127688076 15:61368004-61368026 CATGGAGGAAGGTTATGCATGGG + Intergenic
1128642921 15:69353073-69353095 CAGGGATGGAGGTTATGCACTGG + Intronic
1129446503 15:75622646-75622668 CTGGGATGGAGGTTAAGCACTGG - Intronic
1130222166 15:82028793-82028815 GAGAGATGGAAGCTATGCATAGG + Intergenic
1130377039 15:83338412-83338434 TAGGGATGAAGGTTATGCATGGG + Intergenic
1130614679 15:85393401-85393423 CAGGGATTAAAGGCATGCATGGG + Intronic
1130804448 15:87304194-87304216 CAGGGATGGAGATTATACAAAGG - Intergenic
1131580529 15:93638539-93638561 CAGGAATGGAAACTCTGCATGGG - Intergenic
1131724138 15:95203647-95203669 CAGGAATGGAGGTTATGCATGGG + Intergenic
1134360799 16:13529481-13529503 AAGGCATGGAGATTATGCATTGG - Intergenic
1135626124 16:23996346-23996368 CAGGGATGGAGGTTATGCATGGG + Intronic
1136251060 16:29005417-29005439 CAGGGATGGAGGTTACGCATGGG + Intergenic
1136733987 16:32445984-32446006 CAAGGATGGAGGCTATGCAGAGG - Intergenic
1137511194 16:49102188-49102210 CAGGGACTGAGGCTATGCATGGG - Intergenic
1137652647 16:50133835-50133857 CAGGGATGGAGGTTAATCATGGG - Intergenic
1138868495 16:60851631-60851653 CAGGGATGGAGGTTACTCATGGG + Intergenic
1140655926 16:77139908-77139930 CAAGGATGGAAGGCAGGCATCGG - Intergenic
1141559425 16:84857191-84857213 CAGGAGTGGAGGTTATGCATGGG - Intronic
1203019094 16_KI270728v1_random:383615-383637 CAAGGATGGAGGTTATGCAGAGG + Intergenic
1203037429 16_KI270728v1_random:656773-656795 CAAGGATGGAGGTTATGCAGAGG + Intergenic
1142588233 17:987734-987756 CAGGGATAAAGGTTATTCATGGG - Intergenic
1143130646 17:4674969-4674991 CAAAGATGGCAGTTATGAATGGG + Intronic
1143790876 17:9294577-9294599 CAGGGATGGGAAGAATGCATGGG + Intronic
1144596950 17:16577921-16577943 CAGGCATGGAGGCTGTGCATGGG + Intergenic
1146238106 17:31186795-31186817 CAGGGATGGAAGTTATGCATGGG + Intronic
1146758553 17:35454979-35455001 CAGGGATGGCGGTTATGCATGGG + Intergenic
1146836477 17:36114822-36114844 CAGGGATGGAGGTTATACATGGG + Intergenic
1146851058 17:36221881-36221903 CAGGGATGGAGGCTACACATGGG + Intronic
1147436524 17:40419916-40419938 CAAGGATGGAAGTTGCCCATGGG + Intergenic
1148628804 17:49090965-49090987 CAGGGGTGCAGGCTATGCATGGG + Intergenic
1149427197 17:56566514-56566536 TAGAGATGGAGCTTATGCATGGG + Intergenic
1149481795 17:57009432-57009454 CGGGGATGGAGGCTATGCATGGG + Intergenic
1149574562 17:57702455-57702477 CTGGGAAGGAAGTTGTGCATTGG + Intergenic
1150851996 17:68712253-68712275 CAGGGTTGGAAGGTACGCTTAGG + Intergenic
1151004703 17:70421051-70421073 TAGGGATGGAGGCAATGCATGGG - Intergenic
1153049238 18:885526-885548 CAGAGATGGAGTCTATGCATGGG + Intergenic
1153089834 18:1331007-1331029 CAGGGATGGAGGTTACACATGGG + Intergenic
1153131154 18:1856878-1856900 CAGGGATGGAAGTTATGTATGGG - Intergenic
1153184515 18:2471571-2471593 TAGGGATGGAGGTTATGCATGGG + Intergenic
1153217564 18:2834758-2834780 CAGGGATGGAGGTTATGCATGGG - Intergenic
1154024832 18:10697279-10697301 TGGGGATGGAAGTGGTGCATGGG - Intronic
1154068590 18:11131927-11131949 CAGGGTTGGAGGTTATACATGGG + Intronic
1154252442 18:12755840-12755862 CAGGGATGGAGGTTACACATGGG - Intergenic
1155234201 18:23803360-23803382 CAGGGATGGAGTTTATCCCTGGG - Intronic
1155336868 18:24773905-24773927 CAGGGATGTAGGTTATCCCTGGG - Intergenic
1155420266 18:25648313-25648335 CAGGGATGGAAGCTATGCATGGG - Intergenic
1156063953 18:33117337-33117359 ATGGGATGGAGGTTATGCATGGG + Intronic
1156118559 18:33816568-33816590 CAGGGATGGAGATTATGCATGGG + Intergenic
1156136326 18:34043436-34043458 CAGAGATCAAAGTTATACATAGG + Intronic
1156303978 18:35859539-35859561 GAGGGATGGAGGTTATGCATGGG + Intergenic
1156546344 18:37967390-37967412 CAGGGATGGAGGGTATACATAGG + Intergenic
1156990183 18:43399931-43399953 CAGGGATGGAGGTTACACATGGG - Intergenic
1156998693 18:43498573-43498595 CAGGAATGGAGGTTATGCATGGG + Intergenic
1157341330 18:46780856-46780878 CAGGGATGGAGGTTAAGCATGGG + Intergenic
1157343885 18:46805867-46805889 CAGTGATGAATGTTAAGCATGGG - Intergenic
1157963464 18:52182228-52182250 TAGGGATAGAGGTTATGCATGGG + Intergenic
1157998379 18:52587280-52587302 TAGGGATGGAGGTTACACATGGG - Intronic
1159151778 18:64531864-64531886 CAAGAATGGAAGTTATGCATGGG - Intergenic
1159272378 18:66169150-66169172 CAGGGGTGGAGATTATGCATGGG - Intergenic
1159558985 18:69974519-69974541 CAGGGATGGAGATTACACATGGG - Intergenic
1159713111 18:71788064-71788086 CACGGTTAGAAGTTGTGCATGGG + Intronic
1159858322 18:73615825-73615847 CAGGAATGGAGGCTATGCATGGG - Intergenic
1160092566 18:75840859-75840881 CAGGGATGGAGGTTACGCATGGG + Intergenic
1160366908 18:78334210-78334232 CAGGGATGGAAGGGACGCAGTGG - Intergenic
1161284137 19:3460097-3460119 AAGGGAGGGGAGTTCTGCATGGG - Intronic
1165155441 19:33784331-33784353 CAGGGATGGAGGTTATGCATGGG + Intergenic
1165155654 19:33785752-33785774 CAGGGATGGAGGCTATGTATAGG + Intergenic
1165405882 19:35630852-35630874 CTTGGATGGAGGTTGTGCATGGG + Intronic
1165497512 19:36162153-36162175 CAGAGATGGAGGCTATGCATGGG - Intergenic
1165560213 19:36672528-36672550 CAGTGATGAAAGTTATGCATGGG + Intergenic
1166998051 19:46729079-46729101 CAGGGAGGGCAGATATGCACTGG + Intronic
1167951743 19:53033085-53033107 CAGGGATGGAGGTTACACATGGG + Intergenic
1168539210 19:57196561-57196583 CAGGGATGGAGGTTGCGCATGGG - Intronic
925175604 2:1781651-1781673 CACGGAAGGAAGTGGTGCATTGG + Intergenic
925460846 2:4061286-4061308 CAGGGATGGAGGTTACACATGGG + Intergenic
926810274 2:16749833-16749855 CAGGAATGAAGGTTATGCATGGG - Intergenic
927008835 2:18880569-18880591 CAGGGATGGAGGTTATACATGGG + Intergenic
929269705 2:39959954-39959976 CAGCAATGGTTGTTATGCATGGG - Intergenic
929550426 2:42887190-42887212 CAGAGATGGAGGTTATGCTGGGG + Intergenic
930118496 2:47740433-47740455 AATGCATGTAAGTTATGCATTGG - Intronic
930132666 2:47868668-47868690 GAGGAATGGAGGTTATACATGGG + Intronic
930295088 2:49544530-49544552 TAGGGATGGAGGTTATGCGTGGG - Intergenic
930418712 2:51121822-51121844 CAGGGATGGAGGTTATGCATGGG + Intergenic
930901096 2:56508597-56508619 CAAGGATAGAGGCTATGCATGGG - Intergenic
930910259 2:56621709-56621731 TAGGGATGGAGGTTACACATGGG + Intergenic
931160199 2:59681198-59681220 CAGGGACATAAATTATGCATTGG - Intergenic
932518063 2:72373978-72374000 CAGGCATGGTAGTTAAGCCTGGG + Intronic
932870577 2:75394240-75394262 GAGGGATGGAGGTTATACATGGG - Intergenic
933265571 2:80177530-80177552 CAGAGATGGAGGTTATGCATGGG - Intronic
933314432 2:80699227-80699249 CAGTGAGGAAAGTTAGGCATAGG + Intergenic
933394350 2:81712513-81712535 CAGGGATGGAGGTTAAGCATGGG - Intergenic
934050650 2:88207712-88207734 CAGGGATGGAAGTCATGCATGGG + Intergenic
934311757 2:91873441-91873463 CAAGGATGGAGGCTATGCAGAGG + Intergenic
934534690 2:95123097-95123119 TAGGGATGGAGGTTACACATGGG - Intronic
935184067 2:100715742-100715764 CAGGGATGGAGGTTACGCATGGG + Intergenic
935407449 2:102723973-102723995 CAGGGATAGAGGTTAAGCACAGG - Intronic
935424986 2:102910481-102910503 CAGGGATGGAGGTTACACATGGG - Intergenic
935440798 2:103093578-103093600 CAGGGATGCCAGTGATTCATAGG + Intergenic
935526957 2:104182232-104182254 CAGGGATGGAGGTTATGCATAGG + Intergenic
935564179 2:104589404-104589426 CAGGGATGGAAGTTACGTATGGG - Intergenic
936147548 2:109990900-109990922 CAGGGGTGGAGGTGATGCCTGGG - Intergenic
936197144 2:110380541-110380563 CAGGGGTGGAGGTGATGCCTGGG + Intergenic
936391206 2:112075679-112075701 AAGGGATGGGAGTTATGTGTAGG + Intronic
936562928 2:113557471-113557493 CAGGGATGAAGGCTATGCACGGG - Intergenic
936646252 2:114376125-114376147 TAGGAATGGAGGTTATGCTTGGG - Intergenic
936799212 2:116245937-116245959 CAGGGATGGAACAAAGGCATAGG + Intergenic
937007040 2:118526408-118526430 AAGGGATGGAGGCTATGCATGGG + Intergenic
937581947 2:123498303-123498325 CAGGGATGGAGGTTATGAATGGG - Intergenic
937765752 2:125658829-125658851 CACGGATGGAAGTCACGCATGGG + Intergenic
937785077 2:125886883-125886905 CAGAGATGGAGGCTATGCATGGG - Intergenic
937852449 2:126647891-126647913 CAGGGATGGAAGTTACGCATGGG - Intergenic
938304617 2:130244120-130244142 CAGGAATGGAAGTTGGGAATTGG - Intergenic
939069203 2:137518731-137518753 CAGGGATGGAGGTTACGCATGGG + Intronic
939213990 2:139213082-139213104 CAGGGATGGAGATTATGCATGGG + Intergenic
939740463 2:145900154-145900176 CAGGGATGGTCGTCATGCACTGG - Intergenic
939806355 2:146779316-146779338 CAGGGATGGAGGCTATGCATGGG + Intergenic
940544257 2:155062977-155062999 CAGAGATAGAGGCTATGCATAGG - Intergenic
940605799 2:155923443-155923465 CAAGCATAGAGGTTATGCATGGG - Intergenic
941948272 2:171123953-171123975 CTGGGAAGGCAGTTATCCATTGG + Intronic
942322062 2:174744351-174744373 CAGGGATGGAGGTTATGCATGGG + Intergenic
943317802 2:186411473-186411495 CAGGGATGGAGGTTATGCATGGG - Intergenic
943385775 2:187202394-187202416 CAGGAATGGAGGTGATGCATGGG - Intergenic
943480485 2:188411427-188411449 CAGGGATGGAGGTTAGGCATGGG - Intronic
943517474 2:188906411-188906433 CAGGGATGGAGGTTATGCATGGG - Intergenic
943833492 2:192490300-192490322 CAGGGAGGGAGGTTATTCATGGG - Intergenic
944406047 2:199385049-199385071 CAAGGATGGAAGAAATGAATGGG - Intronic
945544976 2:211138954-211138976 CAAGGATGGAGGTTATGCATGGG + Intergenic
945642301 2:212444682-212444704 CAGGGATGGAGGTTATGCATGGG + Intronic
945717720 2:213379825-213379847 CAGGGATGGAGGTTACGCATGGG - Intronic
945725727 2:213470657-213470679 GAGGATTGGAGGTTATGCATGGG - Intronic
946151020 2:217770698-217770720 CAGGGATGGAGGTTACACAAGGG + Intergenic
946527753 2:220539191-220539213 CAGGGATGGAAGTTACACATGGG - Intergenic
946703638 2:222436949-222436971 CAGTGATGGAGGTTACGCATGGG - Intronic
947440968 2:230121098-230121120 CAGGGATGGAGGTTATGCTTGGG + Intergenic
948340323 2:237245517-237245539 CAGGGATGGAGGGGATGCATGGG - Intergenic
948581495 2:238989994-238990016 CATGTATGCAAGGTATGCATTGG + Intergenic
1169610985 20:7379889-7379911 TAGGAATGGAGGTTATGCATGGG - Intergenic
1170604780 20:17867696-17867718 CAGGGAAGCAAGTTATGGCTGGG + Intergenic
1171315977 20:24195057-24195079 CAGGGAGGGATGTTATGCATGGG + Intergenic
1171329945 20:24328798-24328820 CAGGGATGGAGGTTATGCATGGG - Intergenic
1171409689 20:24937789-24937811 CAGGGATGGAGGTTGTGCATGGG - Intergenic
1171436247 20:25126790-25126812 CAGGGATGGAGCTTACACATGGG + Intergenic
1173141797 20:40491248-40491270 CGGGGATGGAGGTTTTGCATGGG - Intergenic
1175541998 20:59753851-59753873 CAGGGATGGCAGGTAGGAATCGG + Intronic
1177505444 21:22013360-22013382 CAGAGATGGAGGTTACACATGGG - Intergenic
1177780857 21:25621274-25621296 CAGGGATGGAAGTCATGCAGGGG - Intergenic
1178005922 21:28219588-28219610 CAAGGATGGTTGTTATGCATGGG - Intergenic
1178063193 21:28874537-28874559 CAAGAATAGAGGTTATGCATGGG - Exonic
1179415022 21:41191692-41191714 CAGGGATGGAGGTTACACATGGG - Intronic
1179457976 21:41512738-41512760 CAGGGATGGAGATTATGCATGGG - Intronic
1181181726 22:21073272-21073294 CAAGGATGGAGGTTCTGCCTAGG - Intergenic
1181367270 22:22387686-22387708 CAGGAATGGAGGTTACACATGGG - Intergenic
1181406454 22:22688359-22688381 CAGGGATGGAGGCTGTCCATGGG - Intergenic
1181868722 22:25880785-25880807 CAGTGATGGAGGTTAAGCATGGG + Intronic
1182965830 22:34520143-34520165 CAGGGATGGTGGTTATGCGTGGG + Intergenic
1183859893 22:40662243-40662265 CAGGGATGGAGGTTAAGCATGGG + Intergenic
1184603442 22:45557521-45557543 CAGGGATGGAGGTTACACATGGG - Intronic
1184638562 22:45856188-45856210 CAGTGATGAAGGCTATGCATGGG - Intergenic
949245994 3:1925769-1925791 CAGGGATGGAAGTTATGCATGGG + Intergenic
949395783 3:3613596-3613618 CAGAGATGGCAGTTCTGTATTGG - Intergenic
949445733 3:4131903-4131925 CAAGGATGGAGGTTACACATGGG + Intronic
949639026 3:6014359-6014381 CAGGGATGAAGGTTATGCATTGG + Intergenic
950849023 3:16044207-16044229 CAGGGATGGAACTCCTGCCTAGG - Intergenic
951003687 3:17593331-17593353 CAGGGATGGAGGTTACACACGGG + Intronic
951291402 3:20875898-20875920 TAGGGATGGAGGTTATGCATGGG - Intergenic
951384635 3:22028363-22028385 CAGGGATGGAGGTTACGCATGGG + Intronic
951970644 3:28441042-28441064 CAGGGATGGAGGTTATGCATGGG - Intronic
952587620 3:34911804-34911826 CAAGGATGGAGATTATGCATGGG - Intergenic
953805022 3:46061366-46061388 CAGGAATTGAAGTTATGCATGGG - Intergenic
954003258 3:47574105-47574127 CTGGGATGGAAGCTAAGCAAGGG + Intronic
954054282 3:48008784-48008806 CAGGGATGGAAGTAATGCTTGGG + Intronic
954511362 3:51128821-51128843 CAGGGATGGAGGTTACGCTTGGG - Intronic
954834496 3:53453825-53453847 CAGGGCTGGAGGATACGCATGGG - Intergenic
955418516 3:58715015-58715037 CAGGGATGGAGGTTATGCATGGG - Intergenic
955801768 3:62694082-62694104 CAGGGATAGAAGCTACACATGGG + Intronic
956306986 3:67836475-67836497 CAGGGATGGAGGTTACTCATGGG + Intergenic
956509788 3:69981210-69981232 CAGGGATGGAGGTTACACATGGG + Intergenic
957421753 3:79980231-79980253 CAGGGATGTAGGTTATGAATGGG - Intergenic
957754710 3:84470272-84470294 CAGGGATGGAGGTTATGCATGGG + Intergenic
958258892 3:91355887-91355909 CAGGGATGGAGGTTGTGCATGGG - Intergenic
958487557 3:94731629-94731651 CAGAGATGGAGGTTACACATGGG - Intergenic
958748028 3:98161435-98161457 TAGGGATAGAAGTTATGCCTAGG - Intergenic
958751820 3:98200949-98200971 TAGGGATGGATGTTATGCCTGGG - Intergenic
958934428 3:100241456-100241478 CAGGGATGGAGGTTATGCATGGG + Intergenic
959226658 3:103596436-103596458 CAGGGATGGAGGTTACACATGGG - Intergenic
959237744 3:103746294-103746316 CAAGGATGGAGGTTAGGTATGGG - Intergenic
959439631 3:106360027-106360049 CAGTGATGGAGGTTATGCATGGG + Intergenic
959793554 3:110394288-110394310 CAGGGATGGAGGTCATGCATGGG - Intergenic
959997989 3:112699164-112699186 CAGGGATGGAGGTTACACATGGG + Intergenic
961028128 3:123578970-123578992 CAGTGATGGAAGTAATCCCTTGG - Intronic
961262970 3:125617232-125617254 CAGGGATGGAGGTTATTCATGGG + Intergenic
961710857 3:128827174-128827196 CAGGGATGGAGGTTACACATGGG - Intergenic
962214788 3:133511917-133511939 CAGGGATGGAGGTTATTCATGGG + Intergenic
963269448 3:143271333-143271355 CAGGGCTGGCATTTATGCCTGGG - Intronic
963331688 3:143922529-143922551 CAGGGATGGAGGATACTCATGGG - Intergenic
963358969 3:144245881-144245903 CAAGAAAGGAAGTTATGGATAGG - Intergenic
963379123 3:144506439-144506461 CAAGGATGGAGGTTACGCATGGG - Intergenic
963569118 3:146969842-146969864 CAAGGATGGAAATTATGCATGGG + Intergenic
963630429 3:147724065-147724087 CAGGGATGGAGATTACACATAGG + Intergenic
963661511 3:148132982-148133004 CAGGGATGGAGGTTATGCATGGG + Intergenic
963970195 3:151421109-151421131 CAGGGATGGAGGTTACGCACAGG - Intronic
964137052 3:153355795-153355817 CAGGGATGAAAACTATTCATGGG + Intergenic
964297792 3:155252777-155252799 TTGCGATGGAAGCTATGCATGGG + Intergenic
964443444 3:156736225-156736247 CTGGGTTGGAAGTTTGGCATTGG + Intergenic
964505586 3:157395454-157395476 CAGAGAAGGAGGTTATTCATGGG - Intronic
964679114 3:159318069-159318091 CAGGGATGGAGGTTACACATGGG - Intronic
965259817 3:166467654-166467676 CAAGGGTGGAGGTTATGCAAGGG + Intergenic
965291631 3:166888746-166888768 CAGGGATGGAGGTTACACATTGG - Intergenic
966044209 3:175530075-175530097 CAGGGATGGAAGTTACACATGGG - Intronic
966334806 3:178856184-178856206 CAGAGATTAAAGATATGCATAGG + Intergenic
966661423 3:182418841-182418863 CAGGGAGGGAGTTTATGCATAGG + Intergenic
967235114 3:187376673-187376695 TAAGAATGGAAGGTATGCATGGG - Intergenic
967831912 3:193926833-193926855 CAGGGATGGAGGTTACACATGGG + Intergenic
968765216 4:2464785-2464807 CAGTGAGGGAAGGTCTGCATGGG + Intronic
970629403 4:17924347-17924369 CAGGGATGGAGGTTACACATGGG + Intronic
970941711 4:21641784-21641806 CAGGGACGTAGGTTATGCATTGG + Intronic
971817346 4:31505917-31505939 CAGGGATGGAGGTTATGCATGGG + Intergenic
971857538 4:32062010-32062032 CAGGGATGGAGGTTATACATGGG - Intergenic
971979184 4:33732029-33732051 CAGGAATGTAGGTTATGCATGGG - Intergenic
972085337 4:35207930-35207952 CATGGATGGAGGTTACACATGGG + Intergenic
972093330 4:35316724-35316746 CAGGGGTAGAAGTTATGTATGGG + Intergenic
972201187 4:36716338-36716360 CAGGGATGGAGGTTATGCATGGG - Intergenic
972771764 4:42203854-42203876 CAGGTATGAACATTATGCATTGG - Intergenic
972806041 4:42530173-42530195 CAAGGATGGAGGTTACGCATGGG + Intronic
972882853 4:43447328-43447350 CAGGGATGGAGGTTATGCATGGG - Intergenic
973092701 4:46157940-46157962 CAGGGATGGTGCTTATGCATGGG + Intergenic
973103036 4:46295587-46295609 CAGGGATGGAGCTTATGCATGGG + Intronic
973118551 4:46489889-46489911 CAGGGATGGAGGTTATGCATGGG + Intergenic
973539755 4:51924267-51924289 CATGGATGGAGGCTGTGCATTGG - Intergenic
973749888 4:54004576-54004598 CAAGGGTGAATGTTATGCATTGG - Intronic
974417956 4:61635317-61635339 CCCGAATGGAAGATATGCATTGG - Intronic
974514384 4:62890161-62890183 CAGTGATGGAAGTTCTGTGTGGG - Intergenic
974564902 4:63569155-63569177 CAGGGATGGAGGTTATGCATGGG + Intergenic
974688614 4:65266424-65266446 CATGGATAGAGGTTATGCATGGG + Intergenic
974752144 4:66154983-66155005 CAGTGATAGAAGATGTGCATGGG + Intergenic
974975568 4:68887274-68887296 CATTGATGGAAGTTATGCATGGG - Intergenic
975253858 4:72212328-72212350 CAGGGATGGATGATATGGTTTGG - Intergenic
975386597 4:73766668-73766690 CAGGGATGGAGGTTACACATGGG - Intergenic
975982482 4:80176433-80176455 CAGGGATGGAGGTTACACATGGG - Intergenic
976034087 4:80794978-80795000 CAGGGATGGATGATATGTATGGG - Intronic
976670986 4:87653693-87653715 CTGGGATGGGATTTGTGCATTGG + Intronic
977031765 4:91892654-91892676 CAGGGGTGGAGGTTACTCATGGG + Intergenic
977133646 4:93273500-93273522 CAGGAATGTAACATATGCATAGG - Intronic
977430888 4:96929055-96929077 CCGGGATGGAGGTTACACATGGG + Intergenic
977466128 4:97384220-97384242 CAGGGATGGAGATTACACATGGG + Intronic
977489962 4:97699229-97699251 CAGTGATGGAGGTTATGCATGGG - Intronic
977753038 4:100632480-100632502 CAGAGGTGGAGGTTGTGCATAGG - Intronic
977833108 4:101616995-101617017 CAGGGATGGGGGTTACACATGGG - Intronic
977847000 4:101778419-101778441 CAGGGATGGAAGTTATGCATGGG - Intronic
977898830 4:102395430-102395452 TAGGGATGGAGGTTATGAATGGG + Intronic
978341456 4:107724703-107724725 CAGGGATGGAGGTTATGCATGGG - Intergenic
978485802 4:109252383-109252405 CAGGGATGGAGGTTATACATGGG - Intronic
978772033 4:112466942-112466964 CAGGGATGGAGGTTATGCATGGG - Intergenic
979337179 4:119476580-119476602 GAGGGATGAAGGCTATGCATGGG - Intergenic
979767130 4:124475440-124475462 CAGGGAGGGAGGTTATGCATGGG + Intergenic
979888451 4:126061333-126061355 CAGGGATGGAGCTTATGCATGGG - Intergenic
979898293 4:126188222-126188244 AAGAGATGGAAGTCGTGCATGGG - Intergenic
980385673 4:132086215-132086237 CAGGGATGGAGGTTAGGCATGGG - Intergenic
980418107 4:132519986-132520008 CATGAATGGAGGTTTTGCATAGG - Intergenic
980957848 4:139446759-139446781 CAGGGATGGAGGTTACATATGGG + Intergenic
981088391 4:140707473-140707495 CAGGCATGGAAGTGATGCACTGG - Intronic
981462933 4:145032638-145032660 CAGGAATGGAGGTTACACATGGG + Intronic
981835121 4:149044785-149044807 CAGGGATGGAGGTTATGCAAGGG + Intergenic
981873658 4:149516042-149516064 CAGGGATGGAGGTTATGCATGGG + Intergenic
982293106 4:153799201-153799223 CAGGGAAGGATGTTAAGGATGGG + Intergenic
982293120 4:153799255-153799277 CAGGGAAGGATGTTAAGGATGGG + Intergenic
982597658 4:157406199-157406221 CAGGGATGGAAGTTATGCCTGGG - Intergenic
982623216 4:157732043-157732065 CAGGGATGGAGGTTATGCACGGG - Intergenic
982786832 4:159545985-159546007 CAGAGATGGAGGCTATTCATGGG - Intergenic
982788116 4:159559552-159559574 CAGGGATGGAGGTCAGACATTGG - Intergenic
982835669 4:160117490-160117512 CAGGGATGGAGGTTATGCATGGG + Intergenic
982847900 4:160275145-160275167 CAGGGATGGAGGTTATGCATGGG + Intergenic
983027522 4:162756133-162756155 CAGGGATGGACGTTACTCATGGG + Intergenic
983185192 4:164692419-164692441 CAGGGATGGAGGTTATGCATGGG + Intergenic
983355861 4:166656514-166656536 CAGAGATGGAGGCTATCCATGGG + Intergenic
984060165 4:174981183-174981205 TAGGGACAGAGGTTATGCATGGG - Intergenic
984093844 4:175409737-175409759 CAGGGATGGAGCTTACGCATGGG + Intergenic
984405553 4:179325158-179325180 CAGGAATTGAGGTTATGCATGGG - Intergenic
985832448 5:2244150-2244172 CACGTTTGGAGGTTATGCATGGG + Intergenic
986036922 5:3949606-3949628 CAGGGATGGAGGATACACATGGG - Intergenic
986087224 5:4463562-4463584 CAGGGATGGAGGTTACACATGGG + Intergenic
986261511 5:6151679-6151701 CAGGTTTGGAGGTTATGCATGGG - Intergenic
986531280 5:8739478-8739500 CAGGGATGGAGGTTATGCATGGG - Intergenic
986545464 5:8892091-8892113 CAGGGATGGATGATATGGCTTGG - Intergenic
986743074 5:10720603-10720625 CAGGGATGGAGGTTACGCATGGG + Intronic
986766279 5:10931149-10931171 CAGGGATGGAGGTTACGCATGGG + Intergenic
986959950 5:13200028-13200050 CAGGGATGGAGGTTATGCATGGG + Intergenic
987153306 5:15062512-15062534 CAGGGATGGAGATTATGCATGGG + Intergenic
987175495 5:15303964-15303986 CAGCGATGGAGGCTATACATGGG + Intergenic
987211853 5:15691857-15691879 CAAGGATGGAACCTATGCACAGG + Intronic
987472670 5:18351922-18351944 CAGGGATGGAGGTTAGGCATGGG + Intergenic
987490700 5:18577466-18577488 CAGGGATAGAGGTTACACATGGG - Intergenic
987578222 5:19757466-19757488 CAGGGATGGAGGTTACACATGGG - Intronic
987885568 5:23807345-23807367 CAGGGATGGAGGTTATGCATGGG + Intergenic
987960621 5:24803873-24803895 CAGAAATGGAGGTTATGCCTGGG + Intergenic
987967709 5:24897005-24897027 CAGAGATGGAAGCTATGCATGGG + Intergenic
988079710 5:26400583-26400605 CAGGGTTGGATGTTACACATGGG - Intergenic
988107875 5:26773386-26773408 CAGGAATGGAGGTTATGCATAGG + Intergenic
988160706 5:27516025-27516047 CAGGGATGGAGGTTACCTATGGG - Intergenic
988205179 5:28124508-28124530 CAGGGATGGAGGTTACTCATGGG - Intergenic
988233182 5:28506245-28506267 CAAGGATGGATGTTACACATGGG - Intergenic
988258277 5:28849386-28849408 CAGGGATGAGTGTTATGAATGGG + Intergenic
988924444 5:35975199-35975221 CAGGGATGGAGTTTATGTATGGG + Intronic
989045033 5:37266441-37266463 CAGGGATGGAGGTTACACCTGGG - Intergenic
989097963 5:37798170-37798192 CAGGGATGGAGGTTATGCATGGG + Intergenic
989307382 5:39973778-39973800 CAGGGATGGAGGTTATGCATGGG - Intergenic
989457527 5:41660923-41660945 CAGGGATGGAGGTTATGCATGGG - Intergenic
989486262 5:41995515-41995537 CAGGGATAGAGGTTGCGCATGGG - Intergenic
990771198 5:59247871-59247893 CAGGGACGGAAGATAAGCACAGG - Intronic
991033674 5:62106769-62106791 CAGGGGCGGAGGTTATGCCTGGG + Intergenic
991234273 5:64376020-64376042 CAGGGACGGAGGCTATGCATGGG + Intergenic
991330618 5:65488841-65488863 CAGGGATGGAGGTTACACACGGG - Intergenic
991445210 5:66692481-66692503 CAGGGATGGAAGATGAACATGGG - Intronic
991691941 5:69233949-69233971 CAGGGATGGAGGTTTTAAATAGG - Intergenic
991946267 5:71900970-71900992 CAGGGATGGAGGTTATGCATGGG + Intergenic
992109772 5:73482028-73482050 CAGGGATGGAGGTTATGCATAGG - Intergenic
992243077 5:74790697-74790719 CAGGGATGGTGGTTACGCATGGG + Intronic
992960065 5:81949248-81949270 CAGAGATGGAAGTGATACTTTGG + Intergenic
993231798 5:85246694-85246716 CAGGGATGGAGGATATGCATGGG - Intergenic
993305769 5:86272989-86273011 GAGGGATGGAAGTCAGCCATGGG + Intergenic
993319938 5:86459424-86459446 CAGGGATGGAGATTACACATGGG + Intergenic
993363078 5:87002042-87002064 CAGGGATGAAAGCTATGCATGGG - Intergenic
993367351 5:87050119-87050141 CAAGGATGGAGGTTACACATGGG - Intergenic
993412455 5:87590973-87590995 CAGGAATGGAGGTTATGCATGGG - Intergenic
993663822 5:90670637-90670659 TAGGGATGGAGGTTATGCATAGG + Intronic
993780797 5:92063236-92063258 CAGGGATGGAGGTTACACATGGG + Intergenic
994291246 5:98031109-98031131 CAGGGATGGAGGTTACTCGTGGG - Intergenic
994830250 5:104773118-104773140 CAGAGATGGAGGCTATGCATGGG - Intergenic
994984291 5:106914882-106914904 CAGGGATGGAGGTTACACATGGG - Intergenic
995280868 5:110334102-110334124 CAGGAGTGGAGGCTATGCATAGG - Intronic
995776160 5:115726855-115726877 TAGGGATGGAGGTTATGCATGGG - Intergenic
996164846 5:120211671-120211693 CAGGGATGGAAGTTATGCATGGG - Intergenic
996381610 5:122867585-122867607 CAGGAATAGAGGTTATGCACAGG - Intronic
996392084 5:122972945-122972967 CAGGGATGGAGGTTATGCATGGG - Intronic
996825685 5:127678672-127678694 CAGGGATGGAAGTTATGCATGGG + Intergenic
998290210 5:140907708-140907730 CAGGGATGGAGGTTACACATGGG - Intronic
998990265 5:147807651-147807673 TAGGGATGAAAGCTATGCATTGG - Intergenic
1000070841 5:157739620-157739642 CAGGGAAGGAAGGGATGGATGGG + Exonic
1000417091 5:160994746-160994768 CAGGGATGGAGGTTACTCATGGG + Intergenic
1001173726 5:169445485-169445507 CAGGGATGGAGGTTATGCATAGG + Intergenic
1002998093 6:2305605-2305627 CAGGGATGGAGGTTATGCATGGG + Intergenic
1003695776 6:8405317-8405339 CAGGGATGGAGGTTACTCAGGGG - Intergenic
1003758734 6:9150930-9150952 CAGGGATGGAGGTTACGCATGGG + Intergenic
1003791350 6:9550892-9550914 CAGGGATGGAGGTTACTCATGGG + Intergenic
1004298693 6:14437503-14437525 CAGGGATGAAGATTATGCCTTGG + Intergenic
1004824167 6:19402388-19402410 CAGGGATGGAGGTTATGCATGGG - Intergenic
1004974701 6:20951883-20951905 CAGGCATGGAAGTTTTTAATGGG + Intronic
1005185299 6:23157910-23157932 CAGGGATGGAGGTTACACTTGGG + Intergenic
1005587572 6:27291725-27291747 CAGCGATGGAAACTAAGCATGGG + Intronic
1005782808 6:29210841-29210863 TAGGGATAGAAGCAATGCATGGG + Intergenic
1006001670 6:30969919-30969941 CAGGGATGGAGGTTATGAATGGG + Intergenic
1006062468 6:31434050-31434072 TAGGGATGGAGGGTATACATAGG + Intergenic
1007573232 6:42908261-42908283 CAGGGATGGAAGCTATGTCTGGG + Intergenic
1008032228 6:46709818-46709840 CAGGGAAGAAAGTTATACAGAGG + Intronic
1008079266 6:47177724-47177746 CAGGAATGGAGGTTACACATGGG - Intergenic
1008340384 6:50357124-50357146 CAGGGATGGAGGTTATACATGGG + Intergenic
1008400407 6:51056311-51056333 CAGGGATGGAGGTTACACATGGG + Intergenic
1008801884 6:55378488-55378510 CAAGGATGGCAGCTATGCATGGG - Intronic
1008996362 6:57664686-57664708 CAGGGATGGAGGTTGTGCATGGG + Intergenic
1009184881 6:60563479-60563501 CAGAGATGGAGGTTGTGCATGGG + Intergenic
1009389988 6:63134229-63134251 CAGGGATGGAGGTTATGCATGGG - Intergenic
1009580300 6:65525006-65525028 CAAGGATGGAAATTATGCATGGG - Intronic
1009660573 6:66606085-66606107 CAGTGATGGAGGTTATATATGGG - Intergenic
1009851798 6:69208110-69208132 CAGGAATGGAGGTTACGCATGGG - Intronic
1010107828 6:72189726-72189748 CAGGAATGGAGGTTACGCATGGG - Intronic
1010323690 6:74541336-74541358 CAGGGACAGAGGTTATGCAGGGG + Intergenic
1010325209 6:74555755-74555777 TAGGGATGGAGGTTACACATGGG - Intergenic
1010406872 6:75516020-75516042 CAGGGTTGGAGGATAAGCATGGG - Intergenic
1010426454 6:75733654-75733676 GACAGATGGAAGATATGCATAGG - Intergenic
1010818750 6:80389254-80389276 CAGGGATGGAGGTTACACATGGG + Intergenic
1010854011 6:80814683-80814705 CAGGGATAGAGTTTATGCATGGG - Intergenic
1010938124 6:81885578-81885600 CAGGGATGGAGGTTGCACATGGG - Intergenic
1011039230 6:83012455-83012477 CAGGGATGGACCTTATGCACGGG - Intronic
1011072565 6:83401699-83401721 CAGGGATAGAGGTTATGCATAGG + Intronic
1011095404 6:83656330-83656352 CAGAAATGGAGGTTATGAATAGG + Intronic
1011136542 6:84106556-84106578 CAGGGATGGAGGATATGCATAGG - Intergenic
1011316016 6:86032296-86032318 CAGGGATGGAAGTTGGTAATAGG - Intergenic
1011862896 6:91782601-91782623 CAGTTATGGAAGTGATGCTTAGG + Intergenic
1012288692 6:97424087-97424109 AAGGGATGGATGTCATGCAGGGG - Intergenic
1012362892 6:98405872-98405894 CAGAGATGGAGGTTATGCATAGG - Intergenic
1012397753 6:98819372-98819394 CAGGGGTGGAAGCTATGCATTGG + Intergenic
1012563646 6:100618562-100618584 AAGAGATGAAAATTATGCATGGG + Intronic
1012820891 6:104083608-104083630 CAGGGATGGAGGTTACACACAGG + Intergenic
1012964238 6:105656187-105656209 CAGGAATGGAGGTTATGCCTGGG + Intergenic
1013406794 6:109850646-109850668 CAGGGATGGAGGTCATGCATGGG + Intergenic
1013783743 6:113756471-113756493 CAGGGTTGGAAGTTAAGAACAGG - Intergenic
1014363280 6:120507507-120507529 CAGGGATGGAGGTTATGCATGGG - Intergenic
1014417116 6:121196251-121196273 CAGGGATGGAGGTTACTCATGGG + Intronic
1014446528 6:121534554-121534576 TAGGGATGGAGATTATGCATGGG - Intergenic
1014631763 6:123797638-123797660 CAGGGACGGAGGTTACACATGGG + Intergenic
1015095330 6:129408755-129408777 CAGGAATGGAGGTTATGCATAGG - Intronic
1015346037 6:132161020-132161042 AAGGGATGCAGGTTTTGCATGGG + Intergenic
1015443166 6:133271717-133271739 CAGGGATGGAGGTTACACATGGG - Intronic
1015475871 6:133658327-133658349 CAGGGATGGAGGTTATGCATGGG + Intergenic
1015660846 6:135571880-135571902 CAGAGATGAAAGATATACATGGG + Intergenic
1015680522 6:135802686-135802708 CAGCGAAGGAAGCTATGCATGGG - Intergenic
1015862161 6:137692327-137692349 CAGGGATGGAGATTATGCATGGG + Intergenic
1016119814 6:140331848-140331870 CAGGGATGGAGGTTATGCATGGG - Intergenic
1016147206 6:140691869-140691891 CTTGGATAGAGGTTATGCATGGG - Intergenic
1016530987 6:145057995-145058017 CAGTTGTGGAAGTTCTGCATGGG + Intergenic
1017043962 6:150330102-150330124 CAGGGATGGAGGTTATGCGTGGG - Intergenic
1017227687 6:152040242-152040264 CAGGGATGGAGGTTACGCACGGG - Intronic
1017544450 6:155436062-155436084 CTGGGATGGAAGTTATGCAGAGG + Intronic
1017976913 6:159366302-159366324 CAGGGATGGAGGTTACACAGGGG - Intergenic
1017986006 6:159443700-159443722 CTGGGAAGGAAGCTAGGCATAGG + Intergenic
1018349627 6:162943300-162943322 CAGCGATGGCAGCTATGGATGGG - Intronic
1018422888 6:163654645-163654667 CAGAGATGGAGACTATGCATGGG - Intergenic
1018600014 6:165528382-165528404 CAGGGATGGAGGTTACGCATGGG + Intronic
1018954934 6:168403154-168403176 CAGGGATGGAGGATATGCATGGG - Intergenic
1020424559 7:8049691-8049713 CAAGAAAGGAAGTTATGCAGTGG + Intronic
1020710474 7:11598472-11598494 CACAGATGGAGGTTATGGATGGG + Intronic
1021050862 7:15982415-15982437 CAGGGATGGAGGTCATGCATGGG - Intergenic
1021288623 7:18815702-18815724 CAGGGCTGGCAGCTGTGCATAGG + Intronic
1021988936 7:26123766-26123788 CAGGGATGGAGGTTAAGCATGGG + Intergenic
1022079009 7:27001175-27001197 CAGGGATGGAGGTTAAGCATGGG + Intergenic
1024032091 7:45469769-45469791 CAGGGATGGCTGTTATGCATGGG + Intergenic
1024040663 7:45550991-45551013 CAGGGATGGAGGTTGCGCATGGG + Intergenic
1024159077 7:46655939-46655961 CAGGCATGAAGGTTATGCATAGG - Intergenic
1024591180 7:50886204-50886226 TAGGGTAGGAAGTTTTGCATGGG + Intergenic
1024884233 7:54123801-54123823 CAGGGATAAAAGTTACACATAGG - Intergenic
1026467017 7:70662779-70662801 CAGGGTTGGGAGTTAGGCACAGG + Intronic
1027406936 7:77872161-77872183 CAGGGATGGAGGTTACGCATGGG - Intronic
1027685918 7:81278799-81278821 CAGGGATGGAGGTTATGCATGGG + Intergenic
1028141854 7:87282828-87282850 CAGGGATGGAGGTTATGCATGGG + Intergenic
1028237949 7:88383666-88383688 CAGGGAGGGAGGTTACTCATGGG + Intergenic
1028935136 7:96455909-96455931 CAGGGATGGAGGTTATGCATGGG + Intergenic
1030368879 7:108674884-108674906 CAGGGATGGAGGTTATGCATGGG + Intergenic
1030457339 7:109792201-109792223 CAGGAATGGAGGGTATGCATGGG - Intergenic
1030883161 7:114905703-114905725 CAGGGATGGAGGTTGCACATGGG - Intergenic
1031236975 7:119189096-119189118 CAGGGATGGATGTTATGCATAGG + Intergenic
1031682154 7:124688192-124688214 CAGGGATGGAGGTTACGCATGGG + Intergenic
1031833127 7:126650860-126650882 CAGGGATGGAGGTTACGCATGGG + Intronic
1032152982 7:129446115-129446137 CAGGGACGGAAGTTACGCATGGG - Intronic
1032583941 7:133129393-133129415 CAGGGATGGAAGCTATGTATGGG + Intergenic
1032923364 7:136575285-136575307 CAGGGATGGAGGTTACGCATGGG - Intergenic
1033076383 7:138253891-138253913 TAGGGATGGAGGTCATGCATGGG + Intergenic
1033135489 7:138780613-138780635 CAGGGATGGAGGTTGTGCGTGGG - Intronic
1033392397 7:140940310-140940332 CAGGGATGGAGGTTGTGCATGGG + Intergenic
1034169929 7:149055115-149055137 CAGGGATGGAGGTTACGTGTGGG + Intergenic
1035077447 7:156190257-156190279 CAAGGGTGGGAGTCATGCATTGG - Intergenic
1037019994 8:13958457-13958479 CAGGGATAGAGGTTATGCATGGG + Intergenic
1037364464 8:18107418-18107440 CAGGGATGGAGGTTATGCATGGG - Intergenic
1037953778 8:23037237-23037259 CAGGGATGGAGGTTATGTATGGG + Intronic
1038454333 8:27662793-27662815 CAGGTATGGAGGTTACCCATGGG - Intronic
1038875463 8:31543581-31543603 CAGGGTTAGAAGTTTTGCATAGG - Intergenic
1039292218 8:36109087-36109109 CAGGGATGGAGGTTACGCATGGG - Intergenic
1039324052 8:36465701-36465723 CAGGGATGGAGGTTACACATGGG - Intergenic
1039831474 8:41218624-41218646 CATGGATGGAAGTCTTGCATGGG + Intergenic
1040912063 8:52529260-52529282 CAGGGATGGAGGTTACACATGGG + Intergenic
1041152842 8:54954422-54954444 CAGAGATGGAAGTTGTATATGGG - Intergenic
1041448101 8:57975679-57975701 CAAGGATGGCAGTTATGCATAGG - Intergenic
1043069217 8:75618109-75618131 AAGGCATGAAAGTTATGTATTGG + Intergenic
1043317625 8:78941048-78941070 CAGGAATGGAGATGATGCATGGG - Intergenic
1044150917 8:88773915-88773937 CAGGGATGGAGGTTACACATGGG + Intergenic
1044202509 8:89453332-89453354 CAGGGATGGAGGTTATGCATGGG + Intergenic
1044285854 8:90411601-90411623 CAGGGATGGAGATTACGCATGGG - Intergenic
1044487036 8:92766339-92766361 CAGGGATGGAGTTTATGCATGGG - Intergenic
1044633027 8:94297558-94297580 CAGGGATGGAGGTTACACATGGG - Intergenic
1044895948 8:96891473-96891495 CAGAGATGGAGGTTACACATGGG - Intronic
1046063886 8:109174389-109174411 CAGGGATGGAAGTTATGCATGGG - Intergenic
1046128551 8:109940752-109940774 CAGGGATGGAGGTTACCCATGGG - Intergenic
1046240957 8:111491610-111491632 GAGGGTTGGAAGTTAAGCACAGG + Intergenic
1046417526 8:113936949-113936971 TAGGGATGGAGGTTACACATGGG - Intergenic
1046585667 8:116146894-116146916 CAGGGATGGAGGTTAAGCATGGG - Intergenic
1047595778 8:126376374-126376396 CAAGGATGGAAAGTATGCTTGGG + Intergenic
1047945062 8:129868636-129868658 CAAAGATTGAAGTTTTGCATAGG - Intronic
1048943260 8:139421184-139421206 CAGGGATGGGAATTACGCACGGG + Intergenic
1049889804 9:58228-58250 CAGGGATGAAGGCTATGCATGGG + Intergenic
1050045023 9:1533974-1533996 CAAGGATGGAGGTCATGCATGGG + Intergenic
1050094013 9:2044953-2044975 CAGAGATGAAAGATATGCTTTGG + Intronic
1050482797 9:6103446-6103468 CAGGGAAGGAGATTATGCATGGG + Intergenic
1050636418 9:7617517-7617539 GAGGAATGGAGGTTATACATGGG + Intergenic
1051145840 9:14026537-14026559 CAGGAATGGAAGATATAAATTGG + Intergenic
1051702757 9:19841906-19841928 CAGGGATGGAGGCTAAGCATGGG + Intergenic
1051885829 9:21891639-21891661 CAGGGATGTCAGTCATTCATAGG - Intronic
1052227703 9:26109216-26109238 CTGGGATGGAGGTTATGCGTGGG + Intronic
1052317782 9:27133919-27133941 CAGAGCTGGAAGTGATGGATAGG + Intronic
1052442145 9:28511445-28511467 CAGGGATGGAGGTTATACATGGG - Intronic
1052497525 9:29246369-29246391 CAAGGATGGAGGTTATGCACGGG + Intergenic
1053164006 9:35831994-35832016 CAGGAATGGAAGTTATCTCTTGG + Intronic
1053731285 9:41059503-41059525 CAGGGATGAAGGCTATGCATGGG + Intergenic
1054697224 9:68372586-68372608 CAGGGGTGAAGGCTATGCATGGG - Intronic
1054727226 9:68664766-68664788 CAGGGATGGAGGTTACCCATGGG + Intergenic
1055903818 9:81270349-81270371 CAGGGATGGAGGTTATGCATGGG - Intergenic
1056314112 9:85372101-85372123 CAGGGGTGGAGGTTATGCATGGG - Intergenic
1056525970 9:87443350-87443372 CAGAGATGGAGGTTATGTATGGG - Intergenic
1057004828 9:91547956-91547978 CAGGGATGGAAGTTATGCATGGG - Intergenic
1057059108 9:91987401-91987423 CAGGGATGGAGATTGTGCACAGG + Intergenic
1057663971 9:97028781-97028803 CAAGAATAGAGGTTATGCATGGG + Intergenic
1058020025 9:100076905-100076927 CAGGGATGGAGGTTACCCATGGG + Intronic
1058259141 9:102808842-102808864 CAGGGATGGAGGTTATGTACGGG - Intergenic
1058544056 9:106041910-106041932 CAAGGATGGAGGTTATGCATGGG - Intergenic
1058876812 9:109251854-109251876 CAGGGATGCAATATAAGCATGGG + Intronic
1059193542 9:112349311-112349333 CTCGGATGGAAGAGATGCATAGG - Intergenic
1059196382 9:112375018-112375040 CAGGGATGGAGGTTATTCATGGG - Intergenic
1059219357 9:112598401-112598423 CAGGGAAGGAATTTAAGCAGGGG + Intronic
1060167799 9:121433830-121433852 CAGGGATGGAAGCTGTGCCAAGG + Intergenic
1060178908 9:121518142-121518164 CACTGATGGAGGTTATCCATGGG + Intergenic
1060321489 9:122565452-122565474 CAGGGATGGAGGTTATGTATGGG + Intergenic
1060805015 9:126569866-126569888 CAGTGATGGAAGTTACGCATGGG - Intergenic
1060833812 9:126739732-126739754 CAGGGATGGAGGTTATTCATAGG - Intergenic
1062135600 9:134925852-134925874 CAGGGATGGAGGTTACACATGGG + Intergenic
1186279627 X:7977961-7977983 CAGGGATGGAGGTTACCCATGGG + Intergenic
1186383976 X:9090933-9090955 CAGGGATGAAGGTTACACATGGG - Intronic
1187524040 X:20037970-20037992 CAGGGATAGAGGTTACACATGGG + Intronic
1187642890 X:21314072-21314094 CAGAAATGGAGGTTATGGATGGG + Intergenic
1188655251 X:32686215-32686237 CAGGGATTAAAATTAGGCATGGG + Intronic
1189032344 X:37463435-37463457 CAGAGATGCAGGTTATACATTGG - Intronic
1189964092 X:46353948-46353970 CAGAGATGGAGTTTATGCATGGG - Intergenic
1190527782 X:51345477-51345499 CAGGGATAGAGGTTATGCACAGG - Intergenic
1190601404 X:52096693-52096715 CAGGGATGATGGTTCTGCATGGG - Intergenic
1190625240 X:52331030-52331052 CAGGGATGCAGGTTATGCACGGG - Intergenic
1190721512 X:53152775-53152797 CAGGGATGGAGGTTATGCATGGG - Intergenic
1190996632 X:55616644-55616666 CAGGGATGGAGGTTACGCATGGG - Intergenic
1191095596 X:56670346-56670368 CAGAGATGGAGGTTACACATGGG - Intergenic
1191588216 X:62851853-62851875 CAGGGATGGCAATTTTACATGGG + Intergenic
1191629906 X:63311741-63311763 CAGGGATGGAGGTTACACATGGG - Intergenic
1191658677 X:63628965-63628987 CAGGGATAGAGGTCATGCATGGG - Intergenic
1191719123 X:64214869-64214891 CAAGGATGGAGGTTATGCACGGG - Intergenic
1191759472 X:64630753-64630775 CAGGCGTGGAGGTTATACATGGG + Intergenic
1191769381 X:64739255-64739277 CAGAGATGGAGGTTATGCATGGG - Intergenic
1191933025 X:66394987-66395009 CAGGGATGGAAGTTACACATCGG + Intergenic
1191941144 X:66483035-66483057 CAGGGATGGAGGTTACGCATGGG - Intergenic
1192297593 X:69867185-69867207 CAGGGATGGAGGTTATGCATGGG - Intronic
1192661458 X:73046940-73046962 CAGGGATGGAGGTTACACATGGG - Intergenic
1192673137 X:73167565-73167587 CAGGGATGGAGGTTACACATAGG - Intergenic
1192898827 X:75472749-75472771 CAAGGATGGAGGTTATGCATGGG + Intronic
1192996297 X:76516419-76516441 TAGGGATGGAGATTATGCAAGGG + Intergenic
1193053612 X:77126610-77126632 CAGGAATGGAAGTTATGCATGGG + Intergenic
1193187477 X:78530048-78530070 AAGGGATGGAGGTTATACCTGGG + Intergenic
1193288039 X:79737070-79737092 TAGTGATGGAAGTTATGCATGGG + Intergenic
1193297894 X:79853499-79853521 CAAGGATGGAGGTTATGCATGGG + Intergenic
1193356367 X:80523971-80523993 CAGGGATGGAGGTTTCACATGGG + Intergenic
1193435368 X:81468825-81468847 CAGAGATAGAGGTTAGGCATAGG - Intergenic
1193447278 X:81619605-81619627 CATGGATGGAAGTTCCACATGGG + Intergenic
1193480357 X:82019824-82019846 CAGAGATGAAGGTTATACATTGG + Intergenic
1193543542 X:82799807-82799829 CAGGGATGGAAATTATTCATTGG + Intergenic
1193573592 X:83174332-83174354 CAGGAATGGAGGTTATGCATGGG - Intergenic
1193833070 X:86310949-86310971 CAGGGATGGAGGTTATGCATGGG + Intronic
1193957410 X:87879060-87879082 CAGGGATGGAGGTTACGCATGGG + Intergenic
1194140713 X:90205331-90205353 CTGAGATGGAGGTTATGCCTGGG - Intergenic
1194163838 X:90489315-90489337 CAGAGATGGAGTTTCTGCATGGG - Intergenic
1194174738 X:90631677-90631699 CAGGGATGGAGGTTATACATGGG + Intergenic
1194210391 X:91063193-91063215 CAGGGATGGAGGTTACACATGGG + Intergenic
1194232973 X:91347129-91347151 CAGGAATGGAGGTTACACATTGG + Intergenic
1194443655 X:93961945-93961967 CAGGGATGGAGGTTATGCATGGG + Intergenic
1194453993 X:94079998-94080020 CAGGGATGGAGGTTACACATGGG - Intergenic
1194485224 X:94478168-94478190 CAGGGATGGAGATTATGCATGGG + Intergenic
1194513307 X:94821407-94821429 CAGGAATGGAGGTTACTCATGGG - Intergenic
1194604258 X:95961010-95961032 CAGGGATGGAGGTTACACATGGG - Intergenic
1194626698 X:96233846-96233868 CAAGGATGGAAGTTGTGTATAGG + Intergenic
1194834068 X:98659642-98659664 CAGGGATGGAGGTTATGCATGGG + Intergenic
1194895619 X:99435829-99435851 TAGGGACGTAGGTTATGCATGGG - Intergenic
1195748401 X:108141228-108141250 CAGGGATAGAGGTTACACATGGG - Intronic
1195748810 X:108144519-108144541 CAGGGATGGAGGTTACACACGGG - Intronic
1195782229 X:108479032-108479054 CAGGGGTGGAGGTTATGCATGGG - Intronic
1195783912 X:108495814-108495836 CAGGGATGGAAATTATGCATGGG + Intronic
1195809671 X:108816006-108816028 CAGGGATGGAGGTTACACATGGG - Intergenic
1196135846 X:112208999-112209021 CAGGGATGGAGGTTAAGCATGGG - Intergenic
1197002411 X:121453758-121453780 CAGAGATGGAGGTTATGCATGGG + Intergenic
1197044536 X:121979151-121979173 CAGGGATGGAGGTTACACACGGG + Intergenic
1197084089 X:122452660-122452682 CAGGGATGGAGTTTACCCATGGG - Intergenic
1197182216 X:123548624-123548646 CAGGGATGGAGGTTACGCATGGG + Intergenic
1197244928 X:124158159-124158181 CAGGGATGGAGGTTACACATGGG - Intronic
1197371936 X:125637023-125637045 CAGGGATGCAGGTCATGCATGGG - Intergenic
1197379885 X:125727048-125727070 CAGGGATGGAGGTTATGCATGGG - Intergenic
1197386659 X:125811400-125811422 CAGGGATGGAGGTTACACATGGG - Intergenic
1197405164 X:126039784-126039806 CAGGGATGGAGGTTATGCATGGG + Intergenic
1197409209 X:126095602-126095624 CAGGGATGGAGGTTACACATGGG - Intergenic
1197419999 X:126227174-126227196 CAGGGATGGAGGTTACGCATGGG + Intergenic
1197477245 X:126940589-126940611 CAGGGATGGAGGTTACCTATGGG - Intergenic
1197537387 X:127707324-127707346 CAGAGATGGAAGCTACGCATAGG + Intergenic
1197591994 X:128420228-128420250 CAGGGATGGAGGTTATGCATGGG + Intergenic
1198066957 X:133107646-133107668 CAGGGATGGATGCTATGGATGGG + Intergenic
1198170120 X:134097083-134097105 CAGGGATGGAGGTTATGCATGGG + Intergenic
1198626406 X:138580771-138580793 CAGGGATGATAGTTAGGCCTTGG + Intergenic
1198701423 X:139401140-139401162 CAGGGATGGAGGTTACGCATGGG + Intergenic
1198782918 X:140256968-140256990 CAGGGATGGAGGTTATGCATGGG - Intergenic
1198934159 X:141888699-141888721 CATGGATGGAGGTTATGCATGGG + Intronic
1199144342 X:144348134-144348156 CAAGGATGCAGGTTATGTATGGG - Intergenic
1199310307 X:146313559-146313581 CAGGGATGGAGGTTATGCATGGG - Intergenic
1199878314 X:151953009-151953031 CAGGTCTGGAAATTATGGATGGG + Intergenic
1200289507 X:154858246-154858268 CAGGGATAGAGGCTATGCATGGG + Intronic
1200486479 Y:3774458-3774480 CTGAGATGGAGGTTATGCCTGGG - Intergenic
1200510101 Y:4067124-4067146 CAGAGATGGAGTTTCTGCATGGG - Intergenic
1200521384 Y:4212866-4212888 CAGGGATGGAGGTTATACATGGG + Intergenic
1200745936 Y:6904028-6904050 CAGGTATGGAGGTTATGCAGGGG - Intergenic
1200976719 Y:9219278-9219300 CAGGGATGGAAGTTATGCATGGG + Intergenic
1201529544 Y:14977066-14977088 CAGGGATGGAGGTTATGCATGGG - Intergenic
1202359841 Y:24096200-24096222 CAGGGGTGAAGATTATGCATGGG + Intergenic
1202510937 Y:25573914-25573936 CAGGGGTGAAGATTATGCATGGG - Intergenic