ID: 996835203

View in Genome Browser
Species Human (GRCh38)
Location 5:127783999-127784021
Sequence TCTCATAAACTTAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996835203_996835209 18 Left 996835203 5:127783999-127784021 CCCTTTACCTTAAGTTTATGAGA No data
Right 996835209 5:127784040-127784062 AGTCTCTTGAAGGCAGAAGATGG No data
996835203_996835208 8 Left 996835203 5:127783999-127784021 CCCTTTACCTTAAGTTTATGAGA No data
Right 996835208 5:127784030-127784052 GTGTTAGGAGAGTCTCTTGAAGG No data
996835203_996835206 -7 Left 996835203 5:127783999-127784021 CCCTTTACCTTAAGTTTATGAGA No data
Right 996835206 5:127784015-127784037 TATGAGAGTCCTTATGTGTTAGG No data
996835203_996835210 22 Left 996835203 5:127783999-127784021 CCCTTTACCTTAAGTTTATGAGA No data
Right 996835210 5:127784044-127784066 TCTTGAAGGCAGAAGATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996835203 Original CRISPR TCTCATAAACTTAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr