ID: 996839849

View in Genome Browser
Species Human (GRCh38)
Location 5:127836323-127836345
Sequence CTATGAAAGCAGCTGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996839849_996839858 15 Left 996839849 5:127836323-127836345 CCCTGCCCCAGCTGCTTTCATAG No data
Right 996839858 5:127836361-127836383 CTGTAGCTTTTCCAGGTGCATGG 0: 20
1: 533
2: 822
3: 1049
4: 992
996839849_996839857 8 Left 996839849 5:127836323-127836345 CCCTGCCCCAGCTGCTTTCATAG No data
Right 996839857 5:127836354-127836376 TGAGTGTCTGTAGCTTTTCCAGG 0: 27
1: 1466
2: 2010
3: 1586
4: 1223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996839849 Original CRISPR CTATGAAAGCAGCTGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr