ID: 996841552

View in Genome Browser
Species Human (GRCh38)
Location 5:127852404-127852426
Sequence TGCAGTGTTTTCTCACATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996841545_996841552 5 Left 996841545 5:127852376-127852398 CCTGTTCAGCCTGTGGAAGAGAG No data
Right 996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG No data
996841542_996841552 20 Left 996841542 5:127852361-127852383 CCCTTAAGGGGAGTACCTGTTCA No data
Right 996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG No data
996841547_996841552 -4 Left 996841547 5:127852385-127852407 CCTGTGGAAGAGAGGCCTCTGCA No data
Right 996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG No data
996841543_996841552 19 Left 996841543 5:127852362-127852384 CCTTAAGGGGAGTACCTGTTCAG No data
Right 996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996841552 Original CRISPR TGCAGTGTTTTCTCACATGG GGG Intergenic
No off target data available for this crispr