ID: 996842030

View in Genome Browser
Species Human (GRCh38)
Location 5:127857494-127857516
Sequence CATTGAAACCAGAGCGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996842026_996842030 27 Left 996842026 5:127857444-127857466 CCTACCTGGTGTTCCTGGATTCA No data
Right 996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG No data
996842028_996842030 14 Left 996842028 5:127857457-127857479 CCTGGATTCATTCTGTCCTACTT No data
Right 996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG No data
996842027_996842030 23 Left 996842027 5:127857448-127857470 CCTGGTGTTCCTGGATTCATTCT No data
Right 996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG No data
996842029_996842030 -2 Left 996842029 5:127857473-127857495 CCTACTTAAATTTATTGTCTACA No data
Right 996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996842030 Original CRISPR CATTGAAACCAGAGCGTATT AGG Intergenic
No off target data available for this crispr