ID: 996843793

View in Genome Browser
Species Human (GRCh38)
Location 5:127877632-127877654
Sequence ATATTATTCTGGGACAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996843793_996843798 10 Left 996843793 5:127877632-127877654 CCATTGTTGTCCCAGAATAATAT No data
Right 996843798 5:127877665-127877687 TCTCAGAAATCTGGTCACCTTGG No data
996843793_996843797 1 Left 996843793 5:127877632-127877654 CCATTGTTGTCCCAGAATAATAT No data
Right 996843797 5:127877656-127877678 AACTGGCATTCTCAGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996843793 Original CRISPR ATATTATTCTGGGACAACAA TGG (reversed) Intergenic
No off target data available for this crispr