ID: 996845283

View in Genome Browser
Species Human (GRCh38)
Location 5:127891972-127891994
Sequence GGCAGCAGTACTGGGTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996845283_996845289 30 Left 996845283 5:127891972-127891994 CCACATTACCCAGTACTGCTGCC No data
Right 996845289 5:127892025-127892047 TTTTTTATCAGAGTACTATTGGG No data
996845283_996845288 29 Left 996845283 5:127891972-127891994 CCACATTACCCAGTACTGCTGCC No data
Right 996845288 5:127892024-127892046 TTTTTTTATCAGAGTACTATTGG No data
996845283_996845286 -8 Left 996845283 5:127891972-127891994 CCACATTACCCAGTACTGCTGCC No data
Right 996845286 5:127891987-127892009 CTGCTGCCTTGCATAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996845283 Original CRISPR GGCAGCAGTACTGGGTAATG TGG (reversed) Intergenic
No off target data available for this crispr