ID: 996845731

View in Genome Browser
Species Human (GRCh38)
Location 5:127896739-127896761
Sequence GAAAATGAAAAGAATCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996845731_996845733 -4 Left 996845731 5:127896739-127896761 CCCAGCTGATTCTTTTCATTTTC No data
Right 996845733 5:127896758-127896780 TTTCTGTGTTTCCTGTTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996845731 Original CRISPR GAAAATGAAAAGAATCAGCT GGG (reversed) Intergenic
No off target data available for this crispr