ID: 996846454

View in Genome Browser
Species Human (GRCh38)
Location 5:127904250-127904272
Sequence CTAAAATCAAGGTTACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996846454_996846457 -2 Left 996846454 5:127904250-127904272 CCTTACTGTAACCTTGATTTTAG No data
Right 996846457 5:127904271-127904293 AGCCCGGTGAAACCTATGTTTGG No data
996846454_996846461 23 Left 996846454 5:127904250-127904272 CCTTACTGTAACCTTGATTTTAG No data
Right 996846461 5:127904296-127904318 TTCCAACCTCCAGAGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996846454 Original CRISPR CTAAAATCAAGGTTACAGTA AGG (reversed) Intergenic
No off target data available for this crispr