ID: 996848931

View in Genome Browser
Species Human (GRCh38)
Location 5:127931492-127931514
Sequence CAATATGCACAGCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996848931_996848940 28 Left 996848931 5:127931492-127931514 CCCTCCTCCAGCTGTGCATATTG No data
Right 996848940 5:127931543-127931565 TGATTTCTGGCCTACCTGTTAGG No data
996848931_996848937 5 Left 996848931 5:127931492-127931514 CCCTCCTCCAGCTGTGCATATTG No data
Right 996848937 5:127931520-127931542 TTGTCAAGAATAGGCTTGCCTGG No data
996848931_996848938 15 Left 996848931 5:127931492-127931514 CCCTCCTCCAGCTGTGCATATTG No data
Right 996848938 5:127931530-127931552 TAGGCTTGCCTGGTGATTTCTGG No data
996848931_996848935 -4 Left 996848931 5:127931492-127931514 CCCTCCTCCAGCTGTGCATATTG No data
Right 996848935 5:127931511-127931533 ATTGCAGCCTTGTCAAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996848931 Original CRISPR CAATATGCACAGCTGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr