ID: 996855561

View in Genome Browser
Species Human (GRCh38)
Location 5:128002339-128002361
Sequence AACACATTGCTTGTTACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996855561_996855563 9 Left 996855561 5:128002339-128002361 CCAGTGGTAACAAGCAATGTGTT No data
Right 996855563 5:128002371-128002393 AACATCTTTGCTACAAATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996855561 Original CRISPR AACACATTGCTTGTTACCAC TGG (reversed) Intergenic
No off target data available for this crispr