ID: 996862614

View in Genome Browser
Species Human (GRCh38)
Location 5:128083556-128083578
Sequence CGCACGGGGCGCTTTTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996862605_996862614 12 Left 996862605 5:128083521-128083543 CCGAGGCCCTTTGCGGACTGGCT No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
996862608_996862614 5 Left 996862608 5:128083528-128083550 CCTTTGCGGACTGGCTGGCCGCG No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
996862604_996862614 13 Left 996862604 5:128083520-128083542 CCCGAGGCCCTTTGCGGACTGGC No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
996862600_996862614 22 Left 996862600 5:128083511-128083533 CCCGCACTGCCCGAGGCCCTTTG No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
996862607_996862614 6 Left 996862607 5:128083527-128083549 CCCTTTGCGGACTGGCTGGCCGC No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
996862601_996862614 21 Left 996862601 5:128083512-128083534 CCGCACTGCCCGAGGCCCTTTGC No data
Right 996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996862614 Original CRISPR CGCACGGGGCGCTTTTGCGT GGG Intergenic
901807667 1:11748493-11748515 GACACGGGCCGCTTTGGCGTGGG + Exonic
913663938 1:121030376-121030398 CCCACTGGGAGATTTTGCGTAGG + Intergenic
914015331 1:143813655-143813677 CCCACTGGGAGATTTTGCGTAGG + Intergenic
914162487 1:145147570-145147592 CCCACTGGGAGATTTTGCGTAGG - Intergenic
914653949 1:149722196-149722218 CCCACTGGGAGATTTTGCGTAGG + Intergenic
914908381 1:151765248-151765270 TGCACTGGCTGCTTTTGCGTTGG + Intronic
1092999365 12:13980912-13980934 CGCGCGGGGCGCGTGCGCGTCGG - Intergenic
1100178653 12:92059674-92059696 CACCCGGGGCGATTTTGCCTTGG - Intronic
1145077502 17:19867812-19867834 CGCTCGGGGCGCTGCTGCGACGG + Exonic
1145197424 17:20907182-20907204 TGCACGCGGCGCTTTTCCCTGGG + Intergenic
1162895692 19:13763647-13763669 TGCACGGGGGGCTTTTCCATGGG - Intergenic
925068833 2:950789-950811 CGCCCGGGGCGGGTCTGCGTGGG + Intergenic
1181322665 22:22020335-22020357 CCCACGGAGCGCTTGTGCTTGGG + Intergenic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
996862614 5:128083556-128083578 CGCACGGGGCGCTTTTGCGTGGG + Intergenic
1035496822 7:159335256-159335278 GGCGCGGGGCGCCTTTGCGAGGG + Intergenic