ID: 996862773

View in Genome Browser
Species Human (GRCh38)
Location 5:128084119-128084141
Sequence GGTCCGCGATGAGGGCCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996862759_996862773 23 Left 996862759 5:128084073-128084095 CCTCGGTGCCGGAGGATGCTGCG 0: 1
1: 0
2: 0
3: 4
4: 178
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100
996862770_996862773 -8 Left 996862770 5:128084104-128084126 CCGGGACGGCGGCGGGGTCCGCG 0: 1
1: 0
2: 3
3: 24
4: 243
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100
996862758_996862773 24 Left 996862758 5:128084072-128084094 CCCTCGGTGCCGGAGGATGCTGC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100
996862765_996862773 0 Left 996862765 5:128084096-128084118 CCCGCGAGCCGGGACGGCGGCGG 0: 1
1: 0
2: 4
3: 17
4: 189
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100
996862760_996862773 15 Left 996862760 5:128084081-128084103 CCGGAGGATGCTGCGCCCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100
996862767_996862773 -1 Left 996862767 5:128084097-128084119 CCGCGAGCCGGGACGGCGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 208
Right 996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996862773 Original CRISPR GGTCCGCGATGAGGGCCCCG CGG Exonic