ID: 996862877

View in Genome Browser
Species Human (GRCh38)
Location 5:128084506-128084528
Sequence CGCCGCCGCCGCCGGAGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 9, 3: 73, 4: 448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996862877 Original CRISPR CGCCGCCGCCGCCGGAGTGC AGG (reversed) Exonic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
900135700 1:1116092-1116114 CGGCGCCACCGCCTGAGGGCGGG - Exonic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900435537 1:2629019-2629041 CTCCGCCTCCGCCGGACTCCCGG - Intronic
900483701 1:2911392-2911414 CGCCGCGGCGGCCGCGGTGCAGG - Intergenic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
901629009 1:10639208-10639230 CGCCGCCGCCGCCGCAGCTGGGG - Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903777141 1:25800350-25800372 CGCCGCTGCCGCCGCCGTCCGGG + Exonic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
903875863 1:26472677-26472699 CGCCGCCGCCTCCCTGGTGCAGG + Intronic
903923394 1:26817331-26817353 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904737655 1:32647104-32647126 CGCCTCGGCCTCCGAAGTGCTGG - Intronic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904794794 1:33051201-33051223 AGCCGCCGCCGCCCGACCGCCGG + Intronic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905449116 1:38046035-38046057 CGCCGCCCGCGCCCGGGTGCAGG + Exonic
905867030 1:41382128-41382150 CCGCGCCGCCGCCGCCGTGCAGG - Exonic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
906120874 1:43389758-43389780 CGCCTCGGCCGCCGCAATGCAGG - Exonic
906321506 1:44820310-44820332 CGGCGCCGCCCACGGGGTGCGGG - Intronic
906436898 1:45803927-45803949 AGCCGCCGCCGCCCGACCGCCGG + Exonic
906486624 1:46240362-46240384 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
906950893 1:50333713-50333735 CGCGGCTGCCGCCGGTGTGTCGG - Intergenic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907429932 1:54405905-54405927 CCGCGCCGCCGCCGGGCTGCGGG - Intronic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
910288908 1:85581291-85581313 CGCCGCGGCTGCCGCAGTGAGGG - Intronic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
911664732 1:100539689-100539711 CGCCGCCGCCGCCGCCTTCCCGG + Exonic
912174683 1:107141229-107141251 CGCCGCCACCGCCGCAGCCCGGG - Intronic
912416226 1:109509742-109509764 CGTCGCCGCCGCCGGAGCCTCGG + Intergenic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
920002147 1:202807673-202807695 CGCCTCCGCTCCCGGGGTGCGGG - Intronic
921060226 1:211578895-211578917 CACCGCCGCCGCCTGGGTGTGGG - Intergenic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921474613 1:215591601-215591623 CGCCTCAGCCTCCGAAGTGCTGG + Intronic
922558193 1:226548927-226548949 CGCCGCCGCCGCCGCCGTCTCGG - Exonic
923163410 1:231337382-231337404 CGCCGCCGCCTCTGGAGGGGAGG - Exonic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1063418190 10:5890154-5890176 CGCCGCCGGAGCCGGACTGACGG - Intergenic
1064202949 10:13299904-13299926 CGGCGCCGCCGCCTGAGTGGTGG - Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064282815 10:13967086-13967108 CGCCTCGGCCTCCGAAGTGCTGG - Intronic
1065597555 10:27330048-27330070 CGCCTCGGCCCCCAGAGTGCTGG + Intergenic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1067118666 10:43455732-43455754 CGCCGAGCCCGCCGGAGGGCGGG + Intronic
1067560379 10:47300783-47300805 CGCGGCCGCCGACGGCCTGCAGG + Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069581977 10:69572573-69572595 AGCCGCCGGCGCCGCACTGCGGG - Exonic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071695426 10:87864079-87864101 CGCCGCCGCCGCCGTGTTGGAGG - Exonic
1071695428 10:87864082-87864104 AGCCGCCGCCGCCGCCGTGTTGG - Exonic
1071784087 10:88880162-88880184 CGCCGCCGCCGCCACAGAGGAGG + Exonic
1072510846 10:96123506-96123528 CGCCTCAGCCTCCAGAGTGCTGG - Intergenic
1072701010 10:97641198-97641220 CGCCGCCGCGGGCTGAGGGCCGG + Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072891540 10:99329495-99329517 GGCCGCCGCCGCCTGGCTGCTGG + Exonic
1072915525 10:99535457-99535479 CGCCGCCGCCGCCGCAGCAGCGG + Exonic
1072915527 10:99535460-99535482 CGCCGCCGCCGCAGCAGCGGCGG + Exonic
1072950152 10:99840240-99840262 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1074121733 10:110498346-110498368 CGCCGCCGCCGCCCTCCTGCAGG - Exonic
1074169678 10:110919828-110919850 CGCCGCCGCCGCCGCTTTCCTGG + Intronic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074182578 10:111077294-111077316 CCCCGCCGCCGCCGCCGTCCCGG + Exonic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1076880174 10:133236157-133236179 CGCCCCCACTGCGGGAGTGCTGG + Intergenic
1077674963 11:4187440-4187462 CGCCGCGGCCGCCGCAGTGTAGG - Intergenic
1077922972 11:6655482-6655504 CGCCGCCGCTGCCGCAGCCCAGG + Intronic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080037295 11:27722643-27722665 CTGCCCCGCCGCCGGGGTGCCGG + Intergenic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1082029502 11:47594261-47594283 CGCCGCCCCTGCCGCAGCGCGGG - Exonic
1083246208 11:61429913-61429935 CGCCGCCGCCGCCATATTCCCGG - Intronic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083922363 11:65787635-65787657 CGCCCCCGCCCCCCGAGTCCCGG - Intronic
1084469367 11:69347552-69347574 CGCCTCAGCCTCCCGAGTGCTGG + Intronic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1085333042 11:75668672-75668694 CGCCGCCGCAGCCGCAGGGAGGG - Exonic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091505362 12:1062229-1062251 CGCCTCGGCCCCCGAAGTGCTGG + Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091762471 12:3096109-3096131 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1092861833 12:12725264-12725286 CGGGGCCGCGGCCGGAGCGCGGG - Intergenic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1095439317 12:42227060-42227082 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1095958426 12:47819445-47819467 GGCCCCGGCCGCCGGTGTGCGGG - Intronic
1096022511 12:48333878-48333900 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1096077641 12:48815143-48815165 CGCAGCCGCCGCCGGAGGATGGG + Intronic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1096749950 12:53752162-53752184 CGCCGCCGCCGCCGCCTTCCAGG + Intergenic
1097046290 12:56189614-56189636 CGCCGCCGCGCCCGGCCTGCCGG - Intergenic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1097284237 12:57865377-57865399 CGCTTCCCCCGCCGGAGCGCCGG + Intergenic
1098123743 12:67269321-67269343 CGCCCCCGCCCCCGGAGCGAAGG + Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1098769722 12:74537990-74538012 CGACCCCGCCGCCGGAGGACTGG + Exonic
1099925911 12:89016997-89017019 TGCCGCCCACGCTGGAGTGCAGG + Intergenic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1101409488 12:104457045-104457067 CGCCGCCGCTGCCGCTGCGCTGG - Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1101935355 12:109052613-109052635 CGCCGCCGCCGCCGGACCGAGGG - Exonic
1103377718 12:120469649-120469671 CGCCGCCGCCGCCTCAGCACGGG + Exonic
1103392537 12:120584813-120584835 CGTGCCCGCCGCCGGAATGCCGG + Intergenic
1103400723 12:120641164-120641186 CGCCGCTGCCGCCGGCCCGCGGG + Exonic
1103433035 12:120904141-120904163 CGCCGCCGCCGCCGCCATGTTGG - Exonic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103826222 12:123741180-123741202 CGCCTCAGCCTCCAGAGTGCTGG - Intronic
1106340243 13:28820240-28820262 CGCCGCCCCCGCTCGAGGGCCGG - Intergenic
1106340284 13:28820398-28820420 CGCCGCCGCCGCCGGCTCTCAGG + Exonic
1107604032 13:42040814-42040836 CCCCGCCGCCGCCGCTGCGCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108214753 13:48173218-48173240 CGCCTCGGCCTCCCGAGTGCTGG + Intergenic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1108688942 13:52845886-52845908 GGTCGCCGCGGCCGAAGTGCCGG - Exonic
1110119770 13:71866572-71866594 CGCCGCCGCCGCCGAAGCGATGG + Exonic
1110573046 13:77026860-77026882 CGCCGCCGTCCCCGGAGCACGGG - Exonic
1110887260 13:80655168-80655190 TGCCGCCCCCGCCGGGCTGCGGG - Intergenic
1111314897 13:86542341-86542363 CGCCTCAGCCTCCCGAGTGCTGG - Intergenic
1112054409 13:95677179-95677201 CGCAGCTGCTGCCGGAGCGCCGG + Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1115183623 14:30658428-30658450 CGTCGCCCCGGCTGGAGTGCAGG + Intronic
1116657969 14:47674982-47675004 CGCCGCCGCCGCCGCAGCTGCGG - Intergenic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117138564 14:52763139-52763161 CGCCTCGGCCCCCAGAGTGCTGG + Intronic
1117176735 14:53153217-53153239 CGCCGCTGCCGCCGCAGCTCGGG - Intronic
1117380055 14:55153291-55153313 CGCCGCTGCCTCCCAAGTGCTGG - Intronic
1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG + Intronic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1119743210 14:77027297-77027319 CGCCGCCGCCGCCGCTGCGGTGG - Exonic
1119831503 14:77707192-77707214 CGCCTCGGCCTCCGAAGTGCGGG + Intronic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1122543357 14:102509680-102509702 AGCCGCCGCGGCCGGATCGCAGG + Exonic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122786146 14:104164135-104164157 CGCTGCAGCCGCCGCAGTGGGGG + Intronic
1122889068 14:104724297-104724319 CGCCGCCTGCGCCGGGGGGCCGG - Intronic
1122964050 14:105112810-105112832 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1123490511 15:20776075-20776097 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1123547012 15:21345162-21345184 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1127144081 15:56007186-56007208 CGCCGCCGCCGCCCGGATCCTGG - Intergenic
1127753436 15:62068009-62068031 CGCCGCCGCCGCCGTAGGTGTGG - Exonic
1128028573 15:64460584-64460606 CGCCGCCGCCGCCGCGATCCGGG - Intergenic
1128743960 15:70100826-70100848 CGCCGCCTCCTCCGCAGAGCCGG + Intergenic
1129893779 15:79089476-79089498 CGCCGCCGCCGCCGCAGTCGCGG - Intronic
1129933729 15:79432339-79432361 CGCCTCCGCCGCCCGAGTCCAGG - Intergenic
1130908604 15:88256350-88256372 CGCCGCCGCCGCCGCCGGGTGGG + Exonic
1131174403 15:90201164-90201186 CCCGGCGGCCGCCGGAGCGCTGG - Intronic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132365190 15:101251771-101251793 CGCCGTCGTCGCCGTCGTGCCGG - Exonic
1202955344 15_KI270727v1_random:72378-72400 CGCCGCCGCCGCCCCAGTGTCGG - Intergenic
1132585879 16:705592-705614 CGCGGGGGCCGCCGGGGTGCTGG + Exonic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1133040880 16:3059244-3059266 CGCCGCCGCCGCCCCTGCGCGGG - Exonic
1133135828 16:3711123-3711145 CGCCGCAGCCCCCAAAGTGCTGG + Intronic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1133924761 16:10183299-10183321 CGTCGCCGCCGAGGGACTGCGGG - Intergenic
1134668092 16:16034274-16034296 CGCCTCAGCCTCCAGAGTGCTGG + Intronic
1135933737 16:26761511-26761533 CGCCTCTGCCTCCGAAGTGCTGG - Intergenic
1136348592 16:29692812-29692834 CGCCTCCGCCTCCCAAGTGCTGG - Intronic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136779114 16:32885984-32886006 CGCCGCCGCCACCGGAGTCTCGG - Intergenic
1136891503 16:33975534-33975556 CGCCGCCGCCACCGGAGTCTCGG + Intergenic
1137605789 16:49786142-49786164 CGCCCCCGCCTCCGGACTGCAGG + Intronic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138471960 16:57245138-57245160 CGCCGCCGACGCCGCAGGTCCGG - Exonic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608590 16:85169273-85169295 CGCCGCCGCCGCCGCGTTCCGGG + Intergenic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1203081528 16_KI270728v1_random:1148072-1148094 CGCCGCCGCCAACGGAGTCTCGG - Intergenic
1142537835 17:632131-632153 CGCCGCAGCCTCCCGAGTACAGG - Intronic
1142711143 17:1724752-1724774 CCCCGCCGCGCCCGGAGCGCAGG + Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142986290 17:3697053-3697075 CACCGACTCCGCCGGAGTGTGGG - Intergenic
1143099813 17:4498906-4498928 CGCAGCCGGGGCCGGAGCGCAGG + Exonic
1143699321 17:8646502-8646524 CGCCTCTGCCCCCGAAGTGCTGG + Intergenic
1143742599 17:8965470-8965492 AGCCGCCGCAGCCCGAGGGCTGG - Intronic
1144339730 17:14301589-14301611 CGCCCCCGCCGCCGGTGAGGAGG + Exonic
1145205639 17:20983901-20983923 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1145970151 17:28951418-28951440 CGCCGCCGCCGTCTGCGTCCCGG + Exonic
1146022637 17:29292911-29292933 CGCCGGCGCCCCCGCAGTGCAGG + Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146365581 17:32223661-32223683 CGCCTCAGCCTCCGAAGTGCTGG + Intronic
1147161783 17:38572827-38572849 CGCCGCGGCCGCCGCCGTGCCGG + Intronic
1147200632 17:38799386-38799408 CACCGCCACCGCCGTGGTGCTGG + Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147325434 17:39667561-39667583 CGGCGCCGCCCCCGAAGTGGCGG + Intergenic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1147963156 17:44179903-44179925 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG + Intergenic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148826461 17:50397620-50397642 CGTCGCCGCCGCCGGAGGGGTGG + Intergenic
1148911384 17:50944816-50944838 CGGGGCCGCCGCAGGAGCGCAGG - Intergenic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149658908 17:58324443-58324465 TCCCGCCGCCGCCGTAGAGCGGG - Intronic
1149908699 17:60550735-60550757 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150236312 17:63595638-63595660 TGCCGCCGCCGCCTTAGTTCAGG - Intergenic
1152361246 17:79834136-79834158 CGCCGCCGACGCCGGTGTCTCGG + Exonic
1152677260 17:81648067-81648089 CGCAGCCACCGCCGGAGCGGCGG - Exonic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1156719183 18:40049175-40049197 CTCCGCCGCCCCCCTAGTGCTGG - Intergenic
1157753010 18:50194977-50194999 CGCCGCCGCGGCGGGAGTAAAGG - Exonic
1158579836 18:58671615-58671637 CGCCGGCGACCCCGGACTGCCGG - Exonic
1158964484 18:62611212-62611234 GGCCGCCGCTGCCTTAGTGCAGG + Intergenic
1160204673 18:76822794-76822816 CGCCGCCGCCGCCGACTGGCCGG + Intronic
1160453356 18:78979805-78979827 CGCCGTCTCCGCCGGCGCGCCGG - Intergenic
1160788737 19:913172-913194 CGCCGCCGCCGCCGCCCGGCAGG + Exonic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930600 19:1568019-1568041 CGCCCCCGCCGCCGTCGGGCTGG + Exonic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161461903 19:4402721-4402743 CGCCTCCGCCGCCTGAGAGGAGG + Exonic
1161628764 19:5340883-5340905 CGCCGCCGCCGCCGCCGGGTCGG + Intergenic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1161963058 19:7533519-7533541 CGCCTGCGCCGCCGGGATGCTGG - Exonic
1162002333 19:7753731-7753753 CGCCTCGGCCCCCAGAGTGCTGG - Intergenic
1162470892 19:10871558-10871580 CGCCGCCGCAGCCGCCGTGCAGG - Exonic
1163577279 19:18118126-18118148 CGCCGCAGCCGCCCGAGGCCGGG - Intronic
1164653368 19:29901816-29901838 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1165632096 19:37310373-37310395 CGCCGCGGCCTCCAAAGTGCTGG - Intergenic
1165850875 19:38849741-38849763 CACCGCCGCCGCCTCCGTGCTGG + Exonic
1165851296 19:38851724-38851746 CGTCGCCCACGCTGGAGTGCAGG - Intronic
1165854203 19:38870152-38870174 CGCCGCAGCCGCCGCAGCTCCGG + Exonic
1165994269 19:39833339-39833361 CGCCGCCACCGCCGCCATGCTGG - Exonic
1166261409 19:41644131-41644153 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1166536077 19:43575597-43575619 CGACGCCGGCGCCGGCGCGCCGG - Exonic
1166543287 19:43619578-43619600 TGCAGCCGCCGCCGCAGAGCCGG - Exonic
1166807585 19:45496630-45496652 CCCCGTCGCCGCCAGAGCGCGGG + Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167569701 19:50279380-50279402 CGCCTCCGCTGCCAAAGTGCTGG - Intronic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168235082 19:55057842-55057864 TGCTGCCGCGGCTGGAGTGCTGG + Intronic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1168695471 19:58401566-58401588 CGCCAGCGCCATCGGAGTGCTGG - Intronic
924962170 2:45581-45603 CGTCGTCGCCGCCGCTGTGCCGG + Exonic
929188791 2:39120994-39121016 CGCCGCCGCCGGTGTAGCGCTGG + Exonic
929983220 2:46699572-46699594 CGCTGCCTCCGCCGCGGTGCGGG - Intronic
930827815 2:55711964-55711986 CGCCTCGGCCTCCGAAGTGCTGG + Intergenic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
932827928 2:74958675-74958697 CGCCGCCGCCGCCGCCATCCCGG - Exonic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
935592618 2:104855840-104855862 TGCCGCCGCCGCCGCCGTGGAGG + Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935997208 2:108787024-108787046 CGCAGCCACGGCGGGAGTGCCGG - Intronic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
938038145 2:128053527-128053549 CGCCGCCGCCGCCCCAATTCTGG + Intergenic
938073211 2:128318981-128319003 CGGCCCCGCCTCCGGAGTGCCGG + Intergenic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
939481040 2:142747409-142747431 CGCCCCAGCCTCCCGAGTGCTGG - Intergenic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948046982 2:234952295-234952317 TGCCACCGCCGCCTGAGTTCGGG + Intronic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948140476 2:235669506-235669528 CGCCGCCGCCGCCGCGCTCCCGG + Intronic
948207742 2:236171577-236171599 CGCTGCCGCCGCCAGAGTCGAGG + Intergenic
948584244 2:239009094-239009116 GGCCGACGCCGACGGAATGCAGG - Intergenic
948953792 2:241272306-241272328 CGGCGCCCCCGCCGGAGCGGGGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1169214621 20:3786019-3786041 GGCAGGCGCCGCCGGGGTGCGGG + Exonic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169915009 20:10674852-10674874 CGACGCCCCGGCCGCAGTGCCGG + Intergenic
1170578225 20:17680742-17680764 CCCCGCGCCCGCCGCAGTGCCGG + Intronic
1172023515 20:31932746-31932768 CGCCTCGGCCTCCAGAGTGCTGG - Intronic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173681554 20:44885791-44885813 CGCTGCCGCCGCCTGAGTAGTGG + Exonic
1175358616 20:58389548-58389570 CGCGGCCTCCGCCCCAGTGCTGG + Intronic
1175439602 20:58981409-58981431 CGTCTCCGCCGCCGGCGGGCCGG + Intronic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176550059 21:8217092-8217114 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176568986 21:8400127-8400149 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176576900 21:8444362-8444384 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1176952668 21:15064961-15064983 CGCCGCCGCCTCCCGAGTTCGGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1180834182 22:18921630-18921652 CGCCGCAGCCCCCAAAGTGCTGG - Intronic
1180960679 22:19761032-19761054 CGCCGCCGCCCCCGGCGCCCCGG + Exonic
1181068784 22:20319999-20320021 CGCCGCCGCCGGCGGCTAGCGGG - Exonic
1181085126 22:20436392-20436414 CGCCGCCGCCGCTGCATTCCTGG + Intronic
1181299188 22:21867423-21867445 CGCCGCCGCCGCCGCCATGTTGG + Exonic
1181348330 22:22236944-22236966 CGCCTCAGCCGCCAAAGTGCTGG - Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1182236952 22:28883653-28883675 CGCCGCCGCCGCCGCCGTGATGG + Exonic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183649338 22:39145287-39145309 CGCCGCGCCCTCCGCAGTGCAGG + Intronic
1183702294 22:39457424-39457446 AGCCGCTGCCGCCGGAGCCCGGG + Exonic
1183845076 22:40536325-40536347 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1184228242 22:43143054-43143076 CGCCGCCGCCCGCCGCGTGCTGG - Exonic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185303211 22:50094972-50094994 CGCCTCAGCCTCCCGAGTGCTGG - Intronic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203254949 22_KI270733v1_random:133418-133440 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203263005 22_KI270733v1_random:178497-178519 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203284270 22_KI270734v1_random:146928-146950 CGCCGCAGCCCCCAAAGTGCTGG - Intergenic
950012386 3:9732378-9732400 CGCCGCCGCATCCGGAGAGTGGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
953485080 3:43286931-43286953 CGCGGCCGCCGCCGCAGTGACGG - Intronic
953989873 3:47475816-47475838 CGCCGCCGCCGCCGCAGCTTGGG - Exonic
954717573 3:52534021-52534043 CGCCGCCATCGCCGGCGTGACGG - Intronic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
958614907 3:96481055-96481077 CGCCTCGGCCACCGAAGTGCTGG + Intergenic
959419622 3:106112748-106112770 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
962738861 3:138348657-138348679 CCCCGCGGCCGCCGGACTGACGG - Intronic
963133246 3:141877030-141877052 CGCCGCCGCCGCCCGGGTTAGGG - Intronic
963236724 3:142963614-142963636 CGCCGCCGCTGCCGCAGCGCGGG - Exonic
963335739 3:143972067-143972089 CGCCGCCGGAGTCGGAGGGCGGG + Exonic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
967880327 3:194297184-194297206 CGCCGCCGCCGCCAGCTTGCTGG + Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968674713 4:1871346-1871368 CGCCGCCGCCGCCGCAGCCGGGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970333149 4:15004223-15004245 CGCCGCAGCAGCCGCAGAGCCGG + Exonic
970333856 4:15011347-15011369 CGCCTCGGCCTCCAGAGTGCTGG + Intronic
970709215 4:18842619-18842641 CGCCACAGCAGCTGGAGTGCAGG - Intergenic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
976812483 4:89111538-89111560 CGCCGCCGGAGCCGGAAGGCGGG - Intergenic
978072541 4:104491325-104491347 CGCCGCCACCGCCGGCGGGGAGG + Exonic
979785647 4:124712702-124712724 CGCCGCCGCCGCCGCCGTCAGGG + Exonic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982288803 4:153759967-153759989 CTCCGCCGCCGCCGCAGATCCGG - Exonic
982616134 4:157637868-157637890 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983077498 4:163343916-163343938 TGCCGCCACCGCCGGGGTGCAGG + Intronic
986858799 5:11903701-11903723 CGCCGCCGCCGCCTGCCGGCCGG + Intronic
989620862 5:43383065-43383087 CGCCTCAGCCCCCGAAGTGCTGG + Intronic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990955023 5:61332320-61332342 CGCCGCCGCCGCCGCCCGGCCGG - Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992373685 5:76170961-76170983 AGCCGCCGCCGCCCGACCGCCGG + Intronic
992880946 5:81109405-81109427 CGCCTCGGCCTCCGAAGTGCTGG - Intronic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
996862814 5:128084232-128084254 CGCCGCCGCCGCCGCAGCAGCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997470504 5:134114676-134114698 AGGCGCCGCCGGCCGAGTGCCGG - Intergenic
999797500 5:155002104-155002126 CGCCTCAGCCGCCTGAGTACTGG - Intergenic
1000985212 5:167858731-167858753 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1001641361 5:173246253-173246275 CTCCGGCGGGGCCGGAGTGCAGG + Intergenic
1002341447 5:178518917-178518939 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006492096 6:34396881-34396903 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1007630306 6:43269747-43269769 AGCCGCCGCCGCCGGGGTGAGGG - Intronic
1007674462 6:43581667-43581689 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1007885797 6:45228728-45228750 AGCCGCCGCCCCCAGAGTTCAGG + Intronic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1011516983 6:88166037-88166059 CGGCGCCGGCGCCGGGCTGCTGG + Exonic
1012139893 6:95613099-95613121 CGCCTCGGCCCCCAGAGTGCTGG - Intergenic
1013484423 6:110583176-110583198 CGCCTCGGCCCCCAGAGTGCTGG + Intergenic
1013836598 6:114342411-114342433 CGCCGCCGCCGCCTGCGTGTGGG - Exonic
1015476504 6:133664191-133664213 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1017446351 6:154510342-154510364 CCCCGCCGCCGCCGGGATCCCGG + Exonic
1017671909 6:156777533-156777555 CGCAGGCCCCGCCGGAGCGCCGG - Intergenic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019279564 7:193021-193043 GGCGCCCGCCGCCGGAGCGCTGG - Exonic
1019404506 7:876638-876660 CGCCGCCGCCGCCATCGGGCCGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019681880 7:2355040-2355062 CCCCGCGGCCTCCGGAGCGCCGG - Exonic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021872113 7:25017856-25017878 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1026973299 7:74480729-74480751 CGCCGCCGCCGGCAGTATGCGGG - Intronic
1027111553 7:75443688-75443710 CGCCTCCGCCTTCGAAGTGCTGG - Intronic
1027283784 7:76628221-76628243 CGCCTCCGCCTTCGAAGTGCTGG - Intergenic
1029281591 7:99439067-99439089 GGCCGCCGCCGCCGCCATGCAGG + Exonic
1029366395 7:100119267-100119289 CGCCCCCGCCACCCGAGCGCGGG + Intronic
1029668308 7:102010143-102010165 CACCCCCGCCTCCGAAGTGCTGG - Intronic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031604224 7:123749025-123749047 CGCCGCCGCTGCGGGAGGGTTGG - Exonic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1034306284 7:150047674-150047696 CGCCGCCGCCGCCGCGCTCCCGG + Intergenic
1034800563 7:154052979-154053001 CGCCGCCGCCGCCGCGCTCCCGG - Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035508140 8:150704-150726 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1035747908 8:1974537-1974559 CGCCGCTGCGCCCGGGGTGCGGG + Intronic
1036466561 8:9003122-9003144 AGTCGCCGCGGCCGGAGGGCGGG + Exonic
1036536904 8:9658415-9658437 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1037825258 8:22156682-22156704 CGCAGCCGGCGCCCGAGGGCAGG - Exonic
1038799678 8:30738409-30738431 CGCCTCGGCCTCCCGAGTGCTGG - Intronic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1041673632 8:60516908-60516930 CGCCGGCGCCGCCGGAGGAAAGG - Exonic
1042556056 8:70034709-70034731 CGCGCGCGCCGCAGGAGTGCCGG + Intergenic
1042837754 8:73093070-73093092 CGCAGGCGCCGCCGGAGCCCTGG - Exonic
1043463894 8:80486696-80486718 CGCCCCCGCCCCCGGCGTTCCGG - Exonic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1043847286 8:85177524-85177546 CGCCCCCGCCGCCGCAGCTCGGG + Exonic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044660436 8:94590116-94590138 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045547365 8:103140795-103140817 CGCCGCCGCCGCCTCCTTGCGGG + Exonic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1046103901 8:109644685-109644707 CGCCGCCGCTGCCGCCGTCCAGG + Exonic
1047687088 8:127315781-127315803 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1052888839 9:33677021-33677043 CGCCGCCGCCGCCGCCGTGTTGG + Intergenic
1052888841 9:33677024-33677046 CGCCGCCGCCGCCGTGTTGGAGG + Intergenic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053070207 9:35096573-35096595 CGCCGCCGCCGCCGCACTTCCGG - Intronic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1053457038 9:38241452-38241474 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1054798660 9:69325489-69325511 CACCGCTGCTGCCGGGGTGCTGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057259764 9:93576983-93577005 CGCCGCCGCCGCCGCATTCCGGG + Intronic
1057313424 9:93955166-93955188 CGCCGCCGCCGCCAAACCGCGGG - Exonic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1057436857 9:95048552-95048574 GGCCGCCGCGGCCGGAGGGGTGG - Intronic
1057489129 9:95508310-95508332 TGCCGCCGCCGCCGCGGTCCTGG + Exonic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1059210830 9:112513612-112513634 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1060064749 9:120494965-120494987 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1060176324 9:121499761-121499783 CGCCGCCTCCGCCCGAGCGGAGG + Intergenic
1060393897 9:123302261-123302283 CGCCTCCGCCTCCAAAGTGCTGG + Intergenic
1060811706 9:126614158-126614180 AGCCGCCGCCGCCGGGTTCCGGG + Intergenic
1060897270 9:127225638-127225660 CGCCGAAGCCGCGGGCGTGCGGG - Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061540912 9:131277519-131277541 CGGCGGCGCCGCCCGAGTGGGGG - Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061984120 9:134119157-134119179 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1062105763 9:134753943-134753965 CGTCGCTGCCGCCGGAGAACGGG - Intronic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1062659198 9:137619365-137619387 CGCCGCCGCCGCCCGCAAGCCGG + Intronic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203471351 Un_GL000220v1:116564-116586 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203479172 Un_GL000220v1:160536-160558 CGCCGCCGCCGCCGGCCCCCCGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1187670036 X:21658140-21658162 CACCGCCGCCCCTGGCGTGCAGG - Exonic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1189262524 X:39688870-39688892 CGCCGCCGCCGCGGCTCTGCAGG + Intergenic
1189324667 X:40105336-40105358 CGCCGCCGCCGCCGCAGTCACGG + Intronic
1189325561 X:40109015-40109037 CGCCGCCGCCGCCGCGTTCCCGG - Intronic
1190320534 X:49177004-49177026 AGCCGCCGCAGCTGGAGTGCCGG - Exonic
1191618342 X:63190430-63190452 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1192425138 X:71068403-71068425 CGCCGCCGCCGCCTGTGGGTTGG - Intronic
1192621050 X:72680746-72680768 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1195036351 X:100973488-100973510 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1196684026 X:118495708-118495730 CGCCGCCGACGCCGTGGGGCAGG + Intergenic
1196707431 X:118727955-118727977 CTCCGCCGCACCCGGAGTTCGGG - Intronic
1200100746 X:153688279-153688301 CGCCGCCGCCGCCGCCCGGCCGG + Exonic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic