ID: 996870519

View in Genome Browser
Species Human (GRCh38)
Location 5:128187178-128187200
Sequence GGGCAGGTTAATCAAAAATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996870519 Original CRISPR GGGCAGGTTAATCAAAAATG GGG Exonic
908714629 1:67056035-67056057 GTGCAGATAAATCAACAATGTGG + Intergenic
908975649 1:69894601-69894623 GGACAGATGAATAAAAAATGTGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
910553976 1:88509091-88509113 GGGCAGTGTAATGAAGAATGTGG - Intergenic
910910410 1:92228138-92228160 GAGCAGGTTAAACACAAGTGTGG - Intronic
916345849 1:163790571-163790593 GGCCAGATTAAAAAAAAATGGGG + Intergenic
916701765 1:167303112-167303134 GGGGAGGTTAATGTCAAATGTGG + Intronic
919451480 1:197776773-197776795 GGGCCTGTTAGTAAAAAATGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
1062941605 10:1425981-1426003 AGGCATGTTACTCAAAAATGCGG + Intronic
1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG + Intergenic
1064800784 10:19068771-19068793 GAGTAAGTTAATCAAAAATTTGG - Intronic
1067923727 10:50486029-50486051 TGTCAGGTTTGTCAAAAATGAGG - Intronic
1068354686 10:55896603-55896625 GGGGAGGTTATTGAAACATGGGG - Intergenic
1068917125 10:62444563-62444585 GGGCAGGTTAAGGAAAAGTTAGG - Intronic
1073670869 10:105586528-105586550 GGGCAGGATAACCAAGAAAGAGG - Intergenic
1074309354 10:112308821-112308843 GGCCAGGCTAAGCAAAACTGGGG + Intergenic
1074839764 10:117338829-117338851 CTGCAGGTAAAGCAAAAATGTGG + Intronic
1076982258 11:210896-210918 GGGCAGGTAGACCAAAAACGGGG - Intronic
1078999594 11:16740134-16740156 AGCCAGGTTACTCAAAAGTGTGG - Intronic
1080463195 11:32473562-32473584 GGGCAGGTCAATGCAAACTGAGG - Intergenic
1085129388 11:74025161-74025183 GGCCACATTAATGAAAAATGGGG - Intronic
1085129564 11:74026522-74026544 GGCCACATTAATGAAAAATGGGG - Intronic
1087697589 11:101397837-101397859 GGACATGTAAATGAAAAATGAGG + Intergenic
1092809849 12:12262844-12262866 AGGTAGGTTAATTAAAGATGGGG - Intronic
1098778151 12:74649290-74649312 GGTGAGCTTAATCAAGAATGTGG + Intergenic
1100811092 12:98339029-98339051 GGGCAGGTGAAAGAAAAATGTGG + Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1104876772 12:132040303-132040325 AGGGAGGTTCCTCAAAAATGTGG + Intronic
1104956695 12:132470180-132470202 AGGGAGGTTCCTCAAAAATGTGG + Intergenic
1106562712 13:30860483-30860505 GGGCAGGGTGAACAAAACTGAGG - Intergenic
1107021724 13:35759211-35759233 AGGCAGGCTAATCAGAAGTGGGG - Intergenic
1108038306 13:46315452-46315474 GGGCAGGGTAGAGAAAAATGAGG + Intergenic
1108421075 13:50250174-50250196 TGCCAGGATAATCAATAATGAGG - Intronic
1109578345 13:64291885-64291907 GGGAAGGTTAATCAACAAAGAGG + Intergenic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1115671387 14:35616247-35616269 AGGCAGGTAAAAGAAAAATGAGG + Intronic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1119853937 14:77885457-77885479 GGGCAGGTTGTTGATAAATGGGG + Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1126942386 15:53780869-53780891 GGGCACGTTAATGCAAAAGGCGG + Intergenic
1128779470 15:70349467-70349489 GGGCAGGTTGATCACAAAGCTGG - Intergenic
1129288125 15:74541668-74541690 GGGGAGGTGAATAAAGAATGGGG + Intronic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130432065 15:83858685-83858707 GAGCAAGTCAATCAAAACTGGGG - Intronic
1130775459 15:86975705-86975727 GGGATGGTTAAGCAAAAATAAGG - Intronic
1131628149 15:94146393-94146415 GGGGAAGGTAAGCAAAAATGGGG + Intergenic
1131807461 15:96137483-96137505 GGGTAGGACAAGCAAAAATGAGG + Intergenic
1134878806 16:17726266-17726288 GGAAAGGTTAAACAAAAAAGTGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1149958118 17:61076267-61076289 GGACAGGTGCCTCAAAAATGTGG + Intronic
1153248024 18:3092756-3092778 GGGGATGCTAAGCAAAAATGTGG - Intronic
1158623173 18:59049898-59049920 GGGAAGGATGATCAAAAAGGCGG + Intergenic
1158692345 18:59671804-59671826 GGGAAGGTTAAAAAAAAAGGGGG + Intronic
1163394486 19:17051381-17051403 GGGGAGGTTAAAAAAAAAAGCGG + Intronic
1168503216 19:56910817-56910839 GGGCAGGTGAATTAAAAAGTTGG + Intergenic
925472823 2:4181290-4181312 GAGCAGGTTCAGCAAAAGTGGGG - Intergenic
925543003 2:4986782-4986804 GTGCTGGTTAATCAGAAAAGTGG - Intergenic
928663366 2:33526293-33526315 GAGCAGACTAATCAAAATTGGGG + Intronic
928886214 2:36151559-36151581 GGAAAGGTTAATAAGAAATGAGG + Intergenic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932251434 2:70248021-70248043 GAAGAGGTTAATCAAAAAGGGGG + Intronic
943056007 2:182980931-182980953 GAGGAGGTTAATCATAAATCAGG - Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1170325822 20:15153293-15153315 GGGTAGGTAAATGAAAAAGGGGG + Intronic
1171047180 20:21821091-21821113 GGGCTGGTTTCTCAGAAATGTGG + Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1175349007 20:58305012-58305034 GAGCTGGTGAATAAAAAATGAGG - Intergenic
1175765455 20:61589761-61589783 GTGCAGGTTAGTTAAATATGGGG - Intronic
1176161615 20:63651571-63651593 GGGCAGGAAACTCAGAAATGTGG + Intronic
1176218402 20:63958827-63958849 GGGCAGGTTAAAAAAAAAAGTGG + Exonic
1177783987 21:25649971-25649993 GAGCAGGTTGTTAAAAAATGAGG - Intronic
1182263793 22:29096138-29096160 GGGGAAGGTAATAAAAAATGGGG - Intronic
1182874160 22:33675680-33675702 TGGCAGGTGACTCAAAATTGTGG - Intronic
1183972379 22:41487318-41487340 GGACAGCTTAATCCAGAATGGGG - Intronic
1184955078 22:47880421-47880443 GGGCAGCTACATTAAAAATGGGG + Intergenic
950176635 3:10879419-10879441 GGGCTGGGTATTCACAAATGGGG - Intronic
950240179 3:11362553-11362575 GGGGATATTAACCAAAAATGAGG - Intronic
950457860 3:13103316-13103338 GGGGCGGTTAATTAAAAAGGTGG - Intergenic
954021921 3:47749793-47749815 GGGCAGGCAAATAAAAAAGGTGG + Intronic
957163013 3:76634625-76634647 GAGGTGATTAATCAAAAATGAGG - Intronic
959240352 3:103784163-103784185 GAGCAGGATAATCAGAAAGGAGG - Intergenic
962002388 3:131312091-131312113 GGGCATGTAAAGCCAAAATGGGG + Intronic
963698390 3:148591974-148591996 GGGCAGGGACATCACAAATGGGG - Intergenic
964845850 3:161043368-161043390 GGCCAGGTCAGTTAAAAATGAGG - Intronic
966875535 3:184319746-184319768 TGGCTGGTTCATCAAAACTGGGG - Exonic
967990019 3:195123759-195123781 GGGCACGATAATCACAAAGGGGG + Intronic
973029201 4:45313818-45313840 GGGCAGGGTGCTCAAATATGTGG + Intergenic
973955649 4:56060514-56060536 GGGCAGAGTGAGCAAAAATGTGG + Intergenic
973977226 4:56274319-56274341 TGGCAGTTTAATACAAAATGAGG + Intronic
974104796 4:57457731-57457753 TGTCAGGTTTATCAAAAATCAGG - Intergenic
974344033 4:60655350-60655372 GGCCAAGTGAACCAAAAATGAGG - Intergenic
976482005 4:85556622-85556644 GGGCAGGTTAATCATATTGGGGG + Intronic
978170248 4:105660978-105661000 GGGGAGGTTAGGAAAAAATGTGG - Intronic
980273660 4:130620188-130620210 GGGTAACTTAATTAAAAATGAGG + Intergenic
980284636 4:130767647-130767669 GGGTAGGTTAAGGAAAAAGGGGG - Intergenic
980689929 4:136281821-136281843 GGGCAGATTAATAGAAAAAGAGG + Intergenic
983104440 4:163668676-163668698 GAGCAGGCTAATCACAAATAAGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986822948 5:11488435-11488457 GAACATGTTAACCAAAAATGCGG + Intronic
988329675 5:29819120-29819142 GGACAGGATAAAGAAAAATGTGG - Intergenic
990796601 5:59549172-59549194 TGCCAGGTTAAGCAAGAATGAGG + Intronic
991188434 5:63838989-63839011 GAGCTGGTTATTCAAAAGTGCGG - Intergenic
993884917 5:93404777-93404799 ACCCAGGTTAATCAAAAATGAGG + Intergenic
994264027 5:97693255-97693277 GGGCAGGTTCTTCAGAAATCTGG - Intergenic
994502228 5:100593566-100593588 CAACAGGTTAATCAGAAATGTGG + Intergenic
995179307 5:109215391-109215413 GGGCAGGGGATTCAGAAATGGGG - Intergenic
996578452 5:125002416-125002438 GGCCAGGTTGAGTAAAAATGTGG + Intergenic
996870519 5:128187178-128187200 GGGCAGGTTAATCAAAAATGGGG + Exonic
998052948 5:139051588-139051610 GGGCTGGGAAATCAAAAAGGAGG - Intronic
998740892 5:145199996-145200018 GGGAAGATTAATGAAAAATGAGG - Intergenic
1000495199 5:161973758-161973780 GGGCAGGTTAATAAAGCAGGTGG + Intergenic
1005135356 6:22563426-22563448 GGGCAGGGCAAAAAAAAATGGGG + Intergenic
1005150368 6:22741865-22741887 GAGCAGGATAATCAAACATTAGG - Intergenic
1010616605 6:78020566-78020588 GGGCAGGTTAATATGAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010994723 6:82520158-82520180 GAGCAAGTTAATCAATTATGGGG + Intergenic
1013559729 6:111292291-111292313 AGGCAGTTAAATTAAAAATGAGG + Intergenic
1014517058 6:122392781-122392803 TCTCAGGTTAGTCAAAAATGGGG + Intergenic
1016590748 6:145740822-145740844 TGGCAGGTTTGTCAAAAATCAGG + Intergenic
1016807060 6:148222216-148222238 GGGCAGATAAATCAACAATTAGG + Intergenic
1021924742 7:25523480-25523502 GAGCAAGTTAATCAAACCTGAGG + Intergenic
1022679864 7:32534601-32534623 GTGCAGGGTAAACAAAAGTGAGG + Intronic
1025629098 7:63251416-63251438 GGGGAAGTTACTCAAAAAAGCGG - Intergenic
1028075226 7:86504536-86504558 TTGCAGGTTTAACAAAAATGAGG - Intergenic
1030136028 7:106249623-106249645 GGGCAGGTTAATAAACATTTTGG + Exonic
1030568622 7:111192709-111192731 TGGCAGGTTAATCAAAGAAAGGG + Intronic
1030654814 7:112155385-112155407 GGGAAGGGTAAACCAAAATGGGG - Intronic
1034978681 7:155462112-155462134 GGGCAGGCTGACCACAAATGAGG - Intronic
1037576317 8:20207195-20207217 GGGAAGAGTAATTAAAAATGAGG + Intronic
1038139888 8:24833021-24833043 GGGAAGATTAATAGAAAATGAGG + Intergenic
1039684958 8:39791346-39791368 AGGCAGATTTATCAGAAATGAGG - Intronic
1040626692 8:49157887-49157909 GGGTAGTTTATTGAAAAATGAGG + Intergenic
1041345132 8:56889282-56889304 GGGCAAGTTACTTAAAAACGTGG - Intergenic
1042064539 8:64859340-64859362 GGGGAGGTTAATCTGAATTGGGG - Intergenic
1043717385 8:83504843-83504865 GGGTAGGTAAATGAAAAAAGGGG + Intergenic
1045165520 8:99600425-99600447 GGGTCAGTTAAGCAAAAATGAGG + Intronic
1046660302 8:116941317-116941339 GGGCATCTTAAACAGAAATGGGG + Intronic
1048809968 8:138276770-138276792 GGGCAGGATATTCAAAATTGGGG + Intronic
1049304543 8:141894004-141894026 GGGCAGATTAAGCAAAAGTGTGG - Intergenic
1050584132 9:7092450-7092472 GGTCAGATTAATGCAAAATGAGG - Intergenic
1051555750 9:18380621-18380643 GAGCAGTTTAATGAAAAATCTGG + Intergenic
1054867296 9:70015538-70015560 GGACATGTTACTCAAAAATATGG + Intergenic
1055363224 9:75517570-75517592 GGGCAGGGGAACCCAAAATGTGG + Intergenic
1186833113 X:13410678-13410700 AGGTAGCTTAATAAAAAATGGGG + Intergenic
1187178928 X:16924539-16924561 GGGTAGGTTGAGGAAAAATGGGG - Intergenic
1190052270 X:47159046-47159068 GGACAGGATAAAGAAAAATGTGG - Intronic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190949550 X:55129922-55129944 GGGAAGATTAATCAAAAAATTGG - Intronic
1190953319 X:55167455-55167477 GGGCAGGTTAATGCAAGTTGAGG - Intronic
1191973829 X:66848142-66848164 GGGAAGGGTAATAGAAAATGGGG + Intergenic
1194408851 X:93532305-93532327 GGGCAGGTTATTGAATCATGGGG + Intergenic
1194452902 X:94066664-94066686 GTGAAGGTTAATAAATAATGGGG + Intergenic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1197914412 X:131519946-131519968 GGGCAGGTAATTGAATAATGGGG + Intergenic
1198681980 X:139192598-139192620 GAGGAGCTTAATAAAAAATGTGG + Intronic