ID: 996870530

View in Genome Browser
Species Human (GRCh38)
Location 5:128187249-128187271
Sequence GTATATGTGAATATAGAGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996870528_996870530 -2 Left 996870528 5:128187228-128187250 CCCATGGTAAGGTTTATATGAGT 0: 1
1: 0
2: 1
3: 5
4: 124
Right 996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 234
996870529_996870530 -3 Left 996870529 5:128187229-128187251 CCATGGTAAGGTTTATATGAGTA 0: 1
1: 0
2: 2
3: 4
4: 115
Right 996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 234
996870527_996870530 -1 Left 996870527 5:128187227-128187249 CCCCATGGTAAGGTTTATATGAG 0: 1
1: 0
2: 0
3: 12
4: 119
Right 996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 234
996870525_996870530 10 Left 996870525 5:128187216-128187238 CCAAAAAGTAACCCCATGGTAAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996870530 Original CRISPR GTATATGTGAATATAGAGCT AGG Exonic
900817003 1:4855646-4855668 AGATATATGAATATAGAGATGGG - Intergenic
905045409 1:34995237-34995259 GTATATATGTATATAGGGTTTGG + Intronic
905117868 1:35658284-35658306 ATATATGTGAACATGGGGCTGGG + Intergenic
905708286 1:40079032-40079054 GTACACGTGAATATAAAGATGGG - Intronic
905828277 1:41043915-41043937 TTATATGTGTATATATAGTTAGG + Intronic
908106071 1:60843493-60843515 GTATATGAAAATATGGGGCTTGG + Intergenic
909737742 1:78985974-78985996 GTATATGTGGATATAAAGAAGGG + Intronic
909922011 1:81393620-81393642 GCATATGTGAATCAAGAGGTAGG + Intronic
910056766 1:83042629-83042651 CTGTATGTCACTATAGAGCTTGG + Intergenic
910728821 1:90368151-90368173 TTATATGTGAATACTGAACTTGG - Intergenic
912234854 1:107838900-107838922 GTATATGTGGACATAAAGATGGG + Intronic
912257507 1:108075873-108075895 GTGTGTGTAAATATACAGCTTGG + Intergenic
912425653 1:109587546-109587568 ATATATGAGAATATGGAGGTAGG + Intronic
912784163 1:112583538-112583560 GTGTATCTGCATATAGTGCTAGG - Intronic
913501461 1:119476181-119476203 GTATATGTGAGTACAGAGAATGG + Intergenic
915811286 1:158914688-158914710 GTATAGGTGAATATAGCTGTGGG + Intergenic
917384988 1:174462721-174462743 GTACATGTGAATATAAAGATTGG - Intronic
917831037 1:178886583-178886605 GAATATGTGAATCTGGAGCTCGG + Intronic
919123470 1:193369420-193369442 CTATATGTGGTTAGAGAGCTGGG - Intergenic
920742767 1:208597181-208597203 GTATATGTGTGTTTAGAGTTGGG + Intergenic
921282873 1:213584790-213584812 GCATGTGTTAATATGGAGCTTGG + Intergenic
921792091 1:219301446-219301468 GAATTTGTGATTATAGAGCATGG + Intergenic
923802499 1:237223987-237224009 GTAGATGTGAATTTAGAGAATGG + Intronic
924407856 1:243770526-243770548 GTATATGAGAAGACAGAGATAGG + Intronic
1064941060 10:20736009-20736031 ATATATGTGAATATAGATGGTGG - Intergenic
1068050168 10:51940444-51940466 TGATATGTGAATATAGGGCTGGG + Intronic
1069007280 10:63332131-63332153 GTCAATGTTAATATAGAGTTTGG - Intronic
1070108360 10:73458624-73458646 GTATATTTTAATATAGAGACAGG - Intronic
1071109999 10:82144617-82144639 GTTTATGTGAAAAGAGATCTGGG + Intronic
1072197987 10:93133023-93133045 GTACATGTGACTGTAGATCTGGG + Intergenic
1078179725 11:9001383-9001405 CTATATTTGAATATACCGCTGGG - Intronic
1079621646 11:22562775-22562797 GTACATGTGAACATAAAGATGGG - Intergenic
1081084524 11:38782902-38782924 GTTTATGTTATTATAGAGATTGG - Intergenic
1081158368 11:39723146-39723168 GTACATCTGGATATAGAGATAGG + Intergenic
1082931848 11:58616728-58616750 ATATCTGTGAATATTGTGCTCGG + Exonic
1083377568 11:62238072-62238094 CTATTAGTCAATATAGAGCTTGG + Intergenic
1083982723 11:66186506-66186528 GATTGTGTGAAAATAGAGCTAGG - Intronic
1087161861 11:94956923-94956945 ATATGTGTTAATATTGAGCTGGG - Intergenic
1087183036 11:95158258-95158280 GTATATGGGCATAGAGAGCAAGG + Intergenic
1088010619 11:104996419-104996441 GTTTCTGTGAATAGAGAACTGGG - Intronic
1088932050 11:114362112-114362134 ATATATGTAAAGATAAAGCTTGG + Intergenic
1091248042 11:134116676-134116698 GTATATGGGAAACTAGACCTGGG + Intronic
1092188788 12:6502256-6502278 GTGCAGGTAAATATAGAGCTTGG + Intronic
1095837790 12:46657052-46657074 ATATTTGTGAAAATAGAGGTGGG + Intergenic
1096612240 12:52810056-52810078 GTACATGTGGACATAGAGCATGG + Intronic
1097655608 12:62358836-62358858 GTATATGTGAAGATATATGTAGG + Intronic
1097678687 12:62629121-62629143 GTATATGAGAATAGAGGTCTTGG + Intergenic
1098914399 12:76241900-76241922 GTATATATATATATAGTGCTAGG - Intergenic
1099155175 12:79166431-79166453 GTATATATCAGTTTAGAGCTTGG - Intronic
1099201301 12:79680553-79680575 GCATATGTGAAAATGGAGTTTGG - Intronic
1099618806 12:84975044-84975066 GTATATTGGAATATGAAGCTGGG - Intergenic
1100408268 12:94290052-94290074 GTATTTGTGATTATAGAGTAAGG + Intronic
1101444151 12:104725435-104725457 GTGTAATTGAATTTAGAGCTGGG - Intronic
1104585013 12:130041514-130041536 ATATATGTGTATATAGATGTAGG + Intergenic
1104606330 12:130192104-130192126 GCATATGTGTATATGGAGGTTGG + Intergenic
1106784098 13:33090090-33090112 GTATATGTCTATATATAGATAGG + Intergenic
1107745386 13:43500632-43500654 GTATATGAAAATATAAATCTTGG + Intronic
1109195022 13:59369243-59369265 CTATATGTGATTAGAGAGCCTGG + Intergenic
1111108985 13:83683098-83683120 GTATATCTGAATCCAGAGCTTGG + Intergenic
1111133738 13:84010852-84010874 ATATATTTGAATATTGAGATAGG + Intergenic
1111603475 13:90504408-90504430 GTTTATGAGAATTTTGAGCTTGG - Intergenic
1113316632 13:109187109-109187131 GAATATGTGAAAATACTGCTTGG - Intronic
1113702972 13:112400902-112400924 CAATATGTGAATACAGAGCCAGG - Intronic
1116571838 14:46528174-46528196 GTTTCTGTAAATATAGTGCTAGG - Intergenic
1116741159 14:48756155-48756177 GTATATGTCAATATAGGATTAGG - Intergenic
1121978473 14:98429921-98429943 GGGGATGTGAATACAGAGCTGGG + Intergenic
1121992637 14:98574535-98574557 GTGTGTGTGAAAATTGAGCTTGG - Intergenic
1122184450 14:99980039-99980061 GTATATGGGAAGATATACCTGGG + Intronic
1124501727 15:30233835-30233857 GTATATGTGAGCATAAAGATGGG - Intergenic
1124741838 15:32304816-32304838 GTATATGTGAGCATAAAGATGGG + Intergenic
1124812569 15:32955732-32955754 GTTTATTTGAATATAGATTTGGG - Intronic
1124870790 15:33540131-33540153 GTTAATGTGCATATAGCGCTTGG - Intronic
1126362040 15:47856655-47856677 ATTGATGTGAAGATAGAGCTGGG + Intergenic
1126469847 15:48997445-48997467 GCAAATTAGAATATAGAGCTTGG + Intronic
1129487211 15:75885929-75885951 GTATATGTAAATATTTGGCTGGG - Intronic
1130819054 15:87473472-87473494 GTACATGTGGACATAGAGGTTGG + Intergenic
1131854258 15:96576201-96576223 ATATATGTGGATATACAACTGGG + Intergenic
1139546121 16:67650427-67650449 GTATATGTGAGGACAGAGATGGG - Intronic
1140354568 16:74294216-74294238 ATAAAAATGAATATAGAGCTGGG - Intergenic
1143849347 17:9798185-9798207 GAATATGTGTATATAAAGCATGG - Intronic
1144912755 17:18696561-18696583 GTATAAATCAATGTAGAGCTGGG + Intergenic
1146185505 17:30721660-30721682 TTATATTTGTTTATAGAGCTGGG + Intergenic
1150216104 17:63470839-63470861 TTAAAACTGAATATAGAGCTGGG + Intergenic
1151244215 17:72781965-72781987 GTATATGTATATATAGAGAGAGG - Intronic
1155761014 18:29567124-29567146 GTATATGAAAATATAGTCCTTGG + Intergenic
1157574420 18:48733991-48734013 GGATATTTGAAAATAAAGCTGGG + Intronic
1158089247 18:53691377-53691399 GTAGATGTGAAAAAACAGCTTGG - Intergenic
1158775939 18:60579751-60579773 GTATATGTGTATATATAGAGAGG + Intergenic
1159082199 18:63747751-63747773 ATATATGTGAATATACACATAGG - Intergenic
1165634685 19:37330885-37330907 CTATAAATGTATATAGAGCTTGG + Intronic
1167193395 19:48008236-48008258 GTATGTGTGTATTTAGAGATAGG + Intronic
1167892178 19:52549275-52549297 GTGTTTGTGAAAACAGAGCTAGG - Intronic
1168502341 19:56903972-56903994 GTATATGTGTGTATATAGATGGG - Intergenic
1168576003 19:57510551-57510573 TTATATGTAAATAAAGAGTTTGG - Intronic
927138665 2:20115085-20115107 GTATTTGTGAATGAATAGCTAGG - Intergenic
929340919 2:40816303-40816325 GTTTTTGAGAATATAAAGCTTGG + Intergenic
929817379 2:45244601-45244623 TTATATGTTAATATTGTGCTTGG - Intergenic
929850027 2:45578400-45578422 GATTATGTGAATTTAGAGATGGG - Intronic
931788380 2:65641938-65641960 CTATATGTGTATATAAAGGTAGG - Intergenic
932036795 2:68253277-68253299 GTTTATGGGAATGCAGAGCTGGG - Intronic
937785703 2:125895071-125895093 ATATATGTGAATATATATATGGG - Intergenic
940754896 2:157670927-157670949 GTATATTTTAATATATAGTTTGG - Intergenic
941391818 2:164924269-164924291 GTACATGTGGATATAAAGATGGG + Intronic
942100220 2:172573468-172573490 GTATATGTGTATATATATATAGG + Intronic
943888748 2:193257698-193257720 GTATATGTGAAAATGATGCTTGG - Intergenic
944493563 2:200283384-200283406 GTATATGTGAATTTGGAGAAAGG + Intergenic
945120245 2:206449976-206449998 GTTTAAGTGAATTTAGATCTTGG + Intronic
945623622 2:212172564-212172586 GTATATGTGTATATACACCATGG + Intronic
947332988 2:229049906-229049928 GTATATATGTATATATATCTTGG - Intronic
1169171433 20:3468889-3468911 GTATGTGTGGATGTAGAGCTGGG + Intergenic
1170915920 20:20625295-20625317 CTATATGTGTATATATGGCTGGG - Intronic
1172632610 20:36389162-36389184 GGATATGTGAATCTAGGGTTTGG + Intronic
1172842532 20:37910616-37910638 GAATATGTAAGTATAGAGCTGGG + Intronic
1173253877 20:41379233-41379255 GTATATGTATATATAGAGAGAGG - Intergenic
1173621516 20:44440490-44440512 GGATATATGAGTCTAGAGCTTGG + Intergenic
1174146728 20:48457228-48457250 GTGTATGTGTATAGTGAGCTTGG - Intergenic
1176984328 21:15419086-15419108 GTAGCTGTGGATATAGAGATAGG + Intergenic
1177095618 21:16828261-16828283 GTATATGTGGATCTTGAGCTAGG - Intergenic
1178340190 21:31779336-31779358 GCAGATGTGTATATAGAGGTAGG + Intergenic
1181133285 22:20746993-20747015 GTTAATGTGAATCTAGAGCCTGG - Intronic
1182960765 22:34472767-34472789 CTATATGTGAATACAAAGATAGG + Intergenic
1183148082 22:36013898-36013920 GTATTTATGAATTTAGAGTTAGG + Intronic
949487720 3:4556017-4556039 GCACATGTGAATGAAGAGCTAGG - Intronic
949561895 3:5210483-5210505 GTATATGTTATTATATAACTAGG - Intronic
950970368 3:17180723-17180745 GTATATATGGACATAGAGCATGG + Intronic
951103391 3:18715172-18715194 ATATATGGGAATTTAGATCTTGG - Intergenic
951409885 3:22350001-22350023 GTAAACATGAATATAGAGTTTGG + Intronic
952107166 3:30084045-30084067 CTTTATGTTAATATAGATCTAGG + Intergenic
952204484 3:31166656-31166678 GTATATGTATATATATGGCTGGG + Intergenic
953938697 3:47070905-47070927 GTATATGTGTGTATAGCGATGGG + Intronic
953965693 3:47304071-47304093 GTATGTGTGTATGTAGAGATAGG - Intronic
955268334 3:57469783-57469805 GTATACATGAACATAGAGATGGG + Intronic
957702793 3:83739235-83739257 ATATATGTAAATATATAACTAGG + Intergenic
957888971 3:86330085-86330107 GTATATATATATATAGGGCTGGG - Intergenic
957929406 3:86859561-86859583 GTATATGGGAATATATATATGGG - Intergenic
958739876 3:98056315-98056337 GAATATGAGAATATGGAGCAGGG - Intergenic
959347324 3:105214854-105214876 GTATTTGTGAATATTTATCTTGG + Intergenic
960070793 3:113427887-113427909 GTATACTTTCATATAGAGCTAGG + Intronic
964217856 3:154308022-154308044 GTATATGTGGACATAGAGTGTGG + Intronic
965553285 3:169992516-169992538 GTATTTGTTAATAAAAAGCTGGG - Intronic
966789166 3:183649236-183649258 GTATCTGTGAATCTAGGGATAGG - Intronic
968034010 3:195530007-195530029 GTATATGTGAAAATAGAGGTTGG - Intronic
972497006 4:39643462-39643484 TCATATTTGAAAATAGAGCTAGG + Intergenic
973255002 4:48101666-48101688 GTGTATGTGTATATAAAGCATGG - Intronic
973925670 4:55735159-55735181 GTATATATGAACATAAAGATAGG + Intergenic
977371556 4:96143526-96143548 GAATATGTGAATCTGGAACTAGG - Intergenic
977601270 4:98936317-98936339 TTATATGTGAATTTTCAGCTGGG + Intergenic
978312031 4:107395292-107395314 GTATATATAAATATATAGCAGGG - Intergenic
979047853 4:115892843-115892865 GTTTATGTGATTATGGAGCCTGG - Intergenic
980334917 4:131459810-131459832 GTATATGCTAATTAAGAGCTGGG - Intergenic
980712352 4:136585968-136585990 GTATATGTATATATATACCTGGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982231528 4:153212339-153212361 GTATATGTGGACATAGAGAGTGG + Intronic
982466274 4:155736823-155736845 GTATATGTAAATATAGCTATTGG + Intergenic
982552914 4:156825202-156825224 GTATCTAGGAATATAGAGATGGG + Intronic
985121490 4:186647445-186647467 GTCTATGTGAATTAAGAGCTTGG - Intronic
988205220 5:28125116-28125138 GTATATTTAAATATAGAATTAGG - Intergenic
992010500 5:72521324-72521346 GTATTTGTGCATATATAGATAGG + Intergenic
993830005 5:92743891-92743913 GTATTTGTGAATATAAAGTAAGG - Intergenic
994105111 5:95938864-95938886 GTATATGAGATTCTAGACCTCGG - Intronic
995053668 5:107735086-107735108 GCACATGTGAAGAAAGAGCTGGG - Intergenic
996257485 5:121423230-121423252 GTATATATGGGTATGGAGCTAGG - Intergenic
996794761 5:127333139-127333161 GTATTTGGGAATATAGATTTGGG + Intronic
996870530 5:128187249-128187271 GTATATGTGAATATAGAGCTAGG + Exonic
997311450 5:132887211-132887233 GTATATGTGAATGGAGAGAGCGG + Intronic
998840409 5:146247662-146247684 GTAAATTTGAAGTTAGAGCTAGG + Intronic
999474330 5:151884592-151884614 GTGTATGTGACTCCAGAGCTGGG + Intronic
1000123863 5:158224707-158224729 GGAAATGTAAATCTAGAGCTTGG - Intergenic
1001458443 5:171886707-171886729 GTATATATAAAAATAGAGTTCGG + Intronic
1004839924 6:19571154-19571176 GTATGTGAGAAGAGAGAGCTGGG + Intergenic
1005137651 6:22589008-22589030 ATATATGATAATATAGAGATGGG + Intergenic
1005159449 6:22842241-22842263 GTACATGTGAATATACAGAGTGG + Intergenic
1006236911 6:32641678-32641700 GAATATGTGATTTTAGAGATGGG - Intronic
1006246913 6:32745527-32745549 GAATATGTGATTTTAGAGATGGG - Intronic
1006716327 6:36123060-36123082 GTAGATGTGAGTTTAGAGTTAGG + Intergenic
1008237572 6:49068915-49068937 GTATATGTGCATATACATATGGG + Intergenic
1008912857 6:56755452-56755474 GTATATGTGAATGTAAAGTGGGG - Intronic
1009468497 6:64002707-64002729 GTGTGTGTGTATATAGAGATAGG + Intronic
1011111426 6:83840918-83840940 GTATGTGTATATATAGAGATAGG + Intergenic
1011406403 6:87019665-87019687 TTATATGGGAGCATAGAGCTGGG - Intergenic
1012099974 6:95070953-95070975 ATATATGTGAATATATATATGGG - Intergenic
1012555297 6:100504446-100504468 GTATTACTGAATATAGAACTTGG - Intergenic
1013944048 6:115701817-115701839 GTATATGTGGATATAGAGGGTGG - Intergenic
1014124001 6:117756962-117756984 ATATATGAGAATAAATAGCTCGG + Intergenic
1014306267 6:119746673-119746695 GTACATGTGAACATAAAGATGGG - Intergenic
1014856890 6:126412874-126412896 GTATTTGTTAACACAGAGCTGGG + Intergenic
1015922200 6:138277768-138277790 GTATATGTTAATATAAAACTGGG + Intronic
1016998940 6:149982155-149982177 ATATATATGAATATAAAGATGGG + Intergenic
1020502318 7:8938901-8938923 AATTATGTGAATATAGAACTCGG + Intergenic
1020673347 7:11147834-11147856 GAATATATGAATTTAGATCTTGG - Intronic
1020789698 7:12611750-12611772 GTATAAATAAATATATAGCTAGG + Intronic
1020798842 7:12708773-12708795 GTATATATAAATATATAGGTAGG - Intergenic
1020903504 7:14036103-14036125 GTATATGTGGAGATGGAGTTTGG + Intergenic
1021001344 7:15334861-15334883 GGATCTGTGAATTTATAGCTAGG - Intronic
1021957358 7:25839365-25839387 ATATATATGATTGTAGAGCTAGG + Intergenic
1023581140 7:41684362-41684384 TTAGATTTGAATATAGACCTGGG + Intergenic
1023971501 7:44994610-44994632 GAAGATGTGATTATTGAGCTGGG + Intergenic
1024149685 7:46558354-46558376 GTATTTGTGAATATAGAAGAAGG + Intergenic
1024511706 7:50209602-50209624 GTAGATGTGGGTCTAGAGCTGGG + Intergenic
1027754322 7:82192502-82192524 GTGTGTGTGAATATAGAGACAGG + Intronic
1028094267 7:86740987-86741009 ATATATGTGTACATAGACCTTGG + Intronic
1030342801 7:108399949-108399971 GTTGATGTGATTATAGAGCACGG - Intronic
1030619218 7:111771192-111771214 GAAAATGTGGATAGAGAGCTTGG - Intronic
1033985869 7:147224771-147224793 GTATATGTGTATATATAGAGAGG - Intronic
1037080199 8:14775628-14775650 GTACATGAGTATATAGAGTTTGG + Intronic
1038725589 8:30079423-30079445 GTTTATTTGAATATAGTTCTTGG - Intronic
1039087166 8:33791425-33791447 GTATATGTATATACAGGGCTCGG + Intergenic
1039247586 8:35626442-35626464 ATATATGAGATTATAGTGCTTGG + Intronic
1041081729 8:54221004-54221026 TTTTATGTGAATATAAAGATAGG - Intergenic
1042024391 8:64407349-64407371 GTATGTGGGACTTTAGAGCTGGG - Intergenic
1043662895 8:82768014-82768036 ATAGAAGTGAATATGGAGCTGGG - Intergenic
1043750731 8:83930463-83930485 CTGTATATGTATATAGAGCTCGG + Intergenic
1046008011 8:108509279-108509301 GTATATGACACTATAGAGCTAGG + Intergenic
1049136907 8:140910712-140910734 CTTCATGTGACTATAGAGCTGGG - Intronic
1049358631 8:142201250-142201272 TTTTATGGGAAAATAGAGCTGGG - Intergenic
1050126763 9:2364226-2364248 GTCTAAGTGAAAATAGAACTTGG + Intergenic
1050812880 9:9772064-9772086 GTATAAGTGTATTTAGAGATAGG + Intronic
1052405512 9:28054885-28054907 GAATATGTGAAAGTAGTGCTTGG - Intronic
1055204117 9:73706986-73707008 GTTTAGTTGAATATACAGCTAGG - Intergenic
1055534002 9:77217500-77217522 GTATATATGGACATAGAGCATGG - Intronic
1056174192 9:84018072-84018094 AAATATGTGAATTTATAGCTGGG + Intergenic
1056301659 9:85248623-85248645 GCATATGTCAATATTGACCTAGG - Intergenic
1056372361 9:85969452-85969474 GTATCTTTGAAGATAGAGCATGG - Intronic
1058746454 9:107996510-107996532 GTATATGTGAAAGGAGAACTTGG + Intergenic
1059026480 9:110638733-110638755 ATTTATGTGAATATAAAACTTGG - Intergenic
1059290543 9:113220443-113220465 GTATATATTAATATAATGCTTGG + Intronic
1186329651 X:8518556-8518578 GTAAATCTGGAAATAGAGCTTGG - Intergenic
1189067427 X:37825299-37825321 ATATATGTGACTATATATCTTGG + Intronic
1189925428 X:45948385-45948407 GTATATGTGTATATATATGTAGG + Intergenic
1192151241 X:68713811-68713833 GAATATATGAATCTGGAGCTTGG - Intronic
1192194634 X:69020031-69020053 GTAACTGTGATTCTAGAGCTGGG + Intergenic
1192858994 X:75045522-75045544 GTACATGTGAATATATACCATGG + Intergenic
1193162930 X:78248289-78248311 GTATATGTGAATGTAGAATGTGG - Intergenic
1193170521 X:78330504-78330526 ATATATGTCTGTATAGAGCTGGG - Intergenic
1193782579 X:85721817-85721839 CTATATGTGATAATAGAGCATGG + Intergenic
1194862006 X:99010979-99011001 GTAAATGGGAATATTCAGCTTGG + Intergenic
1195477007 X:105298592-105298614 ATATATATGAATATGGAGTTTGG + Intronic
1195794329 X:108627384-108627406 ATATATATGCATATAGAGTTTGG + Intronic
1195995537 X:110728286-110728308 GTATATATGATTATATATCTAGG - Intronic
1197189864 X:123634215-123634237 GTATTTGTCAATATAGTTCTAGG - Intronic
1197258731 X:124293259-124293281 ACATATGTGTATATAGAGCATGG - Intronic
1197512250 X:127384677-127384699 TTATATGTGAAAATAAAACTTGG + Intergenic
1198954851 X:142117489-142117511 TTATAAGTGAATATATTGCTTGG - Intergenic
1199392613 X:147298349-147298371 GTATGTGTGTGTATAGAGATGGG - Intergenic
1199757467 X:150878663-150878685 GTATATGTGAATAAAATGCATGG + Intronic
1201295281 Y:12457027-12457049 GTATATGTGTATATACATTTAGG - Intergenic
1201983608 Y:19935906-19935928 GTACATGTGAATATAAAGAAAGG + Intergenic