ID: 996871713

View in Genome Browser
Species Human (GRCh38)
Location 5:128199841-128199863
Sequence CTCATCAGTGATGAATAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996871713_996871720 14 Left 996871713 5:128199841-128199863 CCCACTTATTCATCACTGATGAG No data
Right 996871720 5:128199878-128199900 GAGATTATGGCAGATATTTAAGG No data
996871713_996871718 1 Left 996871713 5:128199841-128199863 CCCACTTATTCATCACTGATGAG No data
Right 996871718 5:128199865-128199887 GAAGGACTACCAAGAGATTATGG No data
996871713_996871721 21 Left 996871713 5:128199841-128199863 CCCACTTATTCATCACTGATGAG No data
Right 996871721 5:128199885-128199907 TGGCAGATATTTAAGGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996871713 Original CRISPR CTCATCAGTGATGAATAAGT GGG (reversed) Intergenic
No off target data available for this crispr