ID: 996871714

View in Genome Browser
Species Human (GRCh38)
Location 5:128199842-128199864
Sequence CCTCATCAGTGATGAATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996871714_996871721 20 Left 996871714 5:128199842-128199864 CCACTTATTCATCACTGATGAGG No data
Right 996871721 5:128199885-128199907 TGGCAGATATTTAAGGTATTAGG No data
996871714_996871720 13 Left 996871714 5:128199842-128199864 CCACTTATTCATCACTGATGAGG No data
Right 996871720 5:128199878-128199900 GAGATTATGGCAGATATTTAAGG No data
996871714_996871718 0 Left 996871714 5:128199842-128199864 CCACTTATTCATCACTGATGAGG No data
Right 996871718 5:128199865-128199887 GAAGGACTACCAAGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996871714 Original CRISPR CCTCATCAGTGATGAATAAG TGG (reversed) Intergenic
No off target data available for this crispr