ID: 996871718

View in Genome Browser
Species Human (GRCh38)
Location 5:128199865-128199887
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996871714_996871718 0 Left 996871714 5:128199842-128199864 CCACTTATTCATCACTGATGAGG No data
Right 996871718 5:128199865-128199887 GAAGGACTACCAAGAGATTATGG No data
996871713_996871718 1 Left 996871713 5:128199841-128199863 CCCACTTATTCATCACTGATGAG No data
Right 996871718 5:128199865-128199887 GAAGGACTACCAAGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type