ID: 996873438

View in Genome Browser
Species Human (GRCh38)
Location 5:128216502-128216524
Sequence TCAGACAAGGAGCTGGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996873438_996873443 1 Left 996873438 5:128216502-128216524 CCTAGGCCCAGCTCCTTGTCTGA No data
Right 996873443 5:128216526-128216548 TTTGGCCACACACAGCAATCCGG No data
996873438_996873444 2 Left 996873438 5:128216502-128216524 CCTAGGCCCAGCTCCTTGTCTGA No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873438_996873446 6 Left 996873438 5:128216502-128216524 CCTAGGCCCAGCTCCTTGTCTGA No data
Right 996873446 5:128216531-128216553 CCACACACAGCAATCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996873438 Original CRISPR TCAGACAAGGAGCTGGGCCT AGG (reversed) Intergenic
No off target data available for this crispr