ID: 996873439

View in Genome Browser
Species Human (GRCh38)
Location 5:128216508-128216530
Sequence CCAAACTCAGACAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996873439_996873444 -4 Left 996873439 5:128216508-128216530 CCCAGCTCCTTGTCTGAGTTTGG No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873439_996873443 -5 Left 996873439 5:128216508-128216530 CCCAGCTCCTTGTCTGAGTTTGG No data
Right 996873443 5:128216526-128216548 TTTGGCCACACACAGCAATCCGG No data
996873439_996873449 30 Left 996873439 5:128216508-128216530 CCCAGCTCCTTGTCTGAGTTTGG No data
Right 996873449 5:128216561-128216583 TTCAGACTAGTAAGTCCTGAAGG No data
996873439_996873446 0 Left 996873439 5:128216508-128216530 CCCAGCTCCTTGTCTGAGTTTGG No data
Right 996873446 5:128216531-128216553 CCACACACAGCAATCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996873439 Original CRISPR CCAAACTCAGACAAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr