ID: 996873444

View in Genome Browser
Species Human (GRCh38)
Location 5:128216527-128216549
Sequence TTGGCCACACACAGCAATCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996873439_996873444 -4 Left 996873439 5:128216508-128216530 CCCAGCTCCTTGTCTGAGTTTGG No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873430_996873444 29 Left 996873430 5:128216475-128216497 CCGCCCCGACACGTGCCTGACCC No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873431_996873444 26 Left 996873431 5:128216478-128216500 CCCCGACACGTGCCTGACCCAAT No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873432_996873444 25 Left 996873432 5:128216479-128216501 CCCGACACGTGCCTGACCCAATT No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873433_996873444 24 Left 996873433 5:128216480-128216502 CCGACACGTGCCTGACCCAATTC No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873438_996873444 2 Left 996873438 5:128216502-128216524 CCTAGGCCCAGCTCCTTGTCTGA No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873436_996873444 9 Left 996873436 5:128216495-128216517 CCCAATTCCTAGGCCCAGCTCCT No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873435_996873444 14 Left 996873435 5:128216490-128216512 CCTGACCCAATTCCTAGGCCCAG No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873437_996873444 8 Left 996873437 5:128216496-128216518 CCAATTCCTAGGCCCAGCTCCTT No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873441_996873444 -5 Left 996873441 5:128216509-128216531 CCAGCTCCTTGTCTGAGTTTGGC No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data
996873429_996873444 30 Left 996873429 5:128216474-128216496 CCCGCCCCGACACGTGCCTGACC No data
Right 996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996873444 Original CRISPR TTGGCCACACACAGCAATCC GGG Intergenic
No off target data available for this crispr