ID: 996874480

View in Genome Browser
Species Human (GRCh38)
Location 5:128226083-128226105
Sequence CCATTCACAGAGGCAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996874472_996874480 11 Left 996874472 5:128226049-128226071 CCCTGGAGCTCCCTAGCAAGGTG No data
Right 996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG No data
996874477_996874480 0 Left 996874477 5:128226060-128226082 CCTAGCAAGGTGAGTAAAGGGAG No data
Right 996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG No data
996874476_996874480 1 Left 996874476 5:128226059-128226081 CCCTAGCAAGGTGAGTAAAGGGA No data
Right 996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG No data
996874473_996874480 10 Left 996874473 5:128226050-128226072 CCTGGAGCTCCCTAGCAAGGTGA No data
Right 996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG No data
996874470_996874480 22 Left 996874470 5:128226038-128226060 CCTCTTAGAAGCCCTGGAGCTCC No data
Right 996874480 5:128226083-128226105 CCATTCACAGAGGCAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996874480 Original CRISPR CCATTCACAGAGGCAGCCAC AGG Intergenic