ID: 996875670

View in Genome Browser
Species Human (GRCh38)
Location 5:128237967-128237989
Sequence CAACCTGCTCCCAATGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996875670_996875675 -1 Left 996875670 5:128237967-128237989 CCTCTTTCATTGGGAGCAGGTTG No data
Right 996875675 5:128237989-128238011 GGAGGGGTCCATTTTGCTGCTGG No data
996875670_996875677 12 Left 996875670 5:128237967-128237989 CCTCTTTCATTGGGAGCAGGTTG No data
Right 996875677 5:128238002-128238024 TTGCTGCTGGTTTAAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996875670 Original CRISPR CAACCTGCTCCCAATGAAAG AGG (reversed) Intergenic
No off target data available for this crispr