ID: 996878441

View in Genome Browser
Species Human (GRCh38)
Location 5:128265931-128265953
Sequence CATTTCAGACAGATTTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996878441_996878443 13 Left 996878441 5:128265931-128265953 CCGGGGGAAATCTGTCTGAAATG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 996878443 5:128265967-128265989 TCCCCCATCAATCATATGAATGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996878441 Original CRISPR CATTTCAGACAGATTTCCCC CGG (reversed) Intronic
900571761 1:3362069-3362091 CCTTCCAGACAGATGTCCCCGGG - Intronic
901270234 1:7947190-7947212 CATGCCAGAATGATTTCCCCAGG - Intergenic
901886802 1:12229557-12229579 CATTTCAGCCACTTTTTCCCCGG - Intergenic
903845428 1:26277242-26277264 CATGTCAGACAGATATGCCCAGG + Exonic
906002904 1:42442527-42442549 CTGTTCTGACAAATTTCCCCAGG - Intronic
907855435 1:58299081-58299103 CAATACAGACAGAATTTCCCAGG - Intronic
909777252 1:79497077-79497099 CACATCAAACAGATTTCCACTGG - Intergenic
911668472 1:100582257-100582279 GATTTGGGACAGATTTCCCATGG + Intergenic
914325742 1:146613810-146613832 AATTTCAAACAGTTTTCCACTGG + Intergenic
916177340 1:162053482-162053504 CATTCTAGACAAATCTCCCCAGG + Intergenic
916856341 1:168754097-168754119 GATTTCAAAGATATTTCCCCAGG + Intergenic
916912489 1:169365996-169366018 CATTTGAGACAGATGTGTCCGGG + Intronic
918201040 1:182267328-182267350 CTTTTGAGACAGAGTTGCCCAGG + Intergenic
918232583 1:182549596-182549618 CATTTCAGCCAGGTGTCCTCTGG - Intronic
919906425 1:202081624-202081646 AAACTCAGACAGTTTTCCCCAGG + Intergenic
921378856 1:214503563-214503585 CATTTCAGTCAGCTCTCCTCAGG + Intronic
923849416 1:237776943-237776965 CATTTCAGACTGATTTCAGATGG + Intronic
924205587 1:241708340-241708362 TTTTTGAGACAGACTTCCCCAGG + Intronic
924587356 1:245371615-245371637 CATGTGACGCAGATTTCCCCAGG - Intronic
1065317867 10:24482140-24482162 CATTTCTGACAGAGTATCCCTGG - Intronic
1067213268 10:44279289-44279311 GATTTCAGACAGCTGTGCCCTGG + Intergenic
1069414774 10:68188643-68188665 CATTTCCTACAGAATTCTCCTGG + Intronic
1071225011 10:83519067-83519089 CTTTTCTGACAGAATGCCCCTGG - Intergenic
1071806254 10:89124322-89124344 CATACCATACAGATTTCTCCTGG + Intergenic
1075499472 10:122959562-122959584 CAGTTCCCACAGATTTCCACTGG - Intronic
1076257555 10:129040238-129040260 CATTTTAGAGAGACTCCCCCTGG - Intergenic
1076616236 10:131756677-131756699 CATGTCAGGCAGAGTTCCCCGGG + Intergenic
1077880430 11:6345093-6345115 TATTTCAGACATATTTTCTCAGG + Intergenic
1079583216 11:22092603-22092625 CATCTTTGACAGGTTTCCCCAGG - Intergenic
1080985439 11:37458229-37458251 CATTTCTCTCAGGTTTCCCCAGG + Intergenic
1081686200 11:45044819-45044841 CATTTTTGTCACATTTCCCCAGG + Intergenic
1083163895 11:60871868-60871890 CATGACAGACAGATTCCCTCGGG - Intronic
1086383983 11:86288410-86288432 TATTTCAGCCAGATTTACTCAGG - Intergenic
1086663736 11:89454226-89454248 CATTTTAGAAATATTTACCCTGG - Intronic
1086795257 11:91093122-91093144 TATTACAGACAGATCTCCACTGG - Intergenic
1087160304 11:94942184-94942206 CATTTCAGACAGACTGGCCAAGG - Intergenic
1087233491 11:95692558-95692580 CATTTTAGAAAGATTGCTCCAGG - Intergenic
1087558209 11:99749565-99749587 GATTTCAGATAAATTTCCCCTGG + Intronic
1089687642 11:120167001-120167023 CCCCTCAGACAGATTTACCCTGG + Intronic
1090110324 11:123900846-123900868 CATTCATGACTGATTTCCCCTGG + Intergenic
1090732820 11:129586537-129586559 CACTCCAGAAAGATTCCCCCAGG + Intergenic
1090863281 11:130673185-130673207 CATTTAAGCCTGATTTCACCTGG - Exonic
1091579578 12:1775460-1775482 AATTTCAGAGTGATTTTCCCTGG - Intronic
1095309303 12:40678752-40678774 AATTTCTGACAGAGTTCCCATGG - Intergenic
1098694332 12:73533328-73533350 TAATTCAGACAGACTTCCTCTGG - Intergenic
1103988427 12:124782343-124782365 CATTTCTAGCAGACTTCCCCAGG + Intronic
1104643630 12:130482547-130482569 GATTTCAGCCAGATTCCACCAGG + Intronic
1109215843 13:59588979-59589001 CATTACAGAATGATTTCCCAAGG + Intergenic
1109743928 13:66595153-66595175 CATTTCAAAGAGATGTTCCCAGG - Intronic
1119882085 14:78107628-78107650 CATTTCATACAGACTTCACAGGG - Intergenic
1120869102 14:89321263-89321285 TTTTTGAGACAGATTTGCCCAGG - Intronic
1124396104 15:29303394-29303416 GATTTCAGACAGATAGCCCATGG + Intronic
1126901747 15:53321649-53321671 CAGTTTAGCCAGAATTCCCCCGG + Intergenic
1129040862 15:72685226-72685248 CATTTAAGACAAGTTTCTCCAGG - Intronic
1130158300 15:81372833-81372855 CATTTCATACAGATGACCCTAGG - Intronic
1133415927 16:5607014-5607036 CATTTTAGAAAGATCTCCCTGGG + Intergenic
1134474123 16:14556489-14556511 CATTTCAGAGATTTTTCTCCTGG + Intronic
1135849832 16:25953242-25953264 CATTTCACAAAGATCTTCCCTGG - Intronic
1136775592 16:32870211-32870233 CTTTTCAGGCACATTTCCCAGGG - Intergenic
1136895025 16:33991301-33991323 CTTTTCAGGCACATTTCCCAGGG + Intergenic
1137068964 16:35881986-35882008 CATTTCAGTCAAATTTCTGCTGG + Intergenic
1138420363 16:56895060-56895082 CATTTCATACAGGTTCCTCCTGG - Intronic
1139791636 16:69441932-69441954 CTTTTCAGACAGATTATCCAGGG - Intronic
1140007824 16:71097130-71097152 AATTTCAAACAGTTTTCCACTGG - Intronic
1140355407 16:74301427-74301449 AATTCCAGACATATTTACCCTGG - Intronic
1140828721 16:78731403-78731425 CAGTGCAGAAAGATTTCCCAAGG - Intronic
1141745696 16:85924677-85924699 CCTTTCAGGAAGATTTTCCCAGG - Intergenic
1203078010 16_KI270728v1_random:1132320-1132342 CTTTTCAGGCACATTTCCCAGGG - Intergenic
1144534929 17:16078958-16078980 CATTTCAGAAAGAAATCACCTGG + Intronic
1144592247 17:16534533-16534555 AATTTCATACAGAGCTCCCCAGG + Intergenic
1151219608 17:72602824-72602846 CATTTCATTCACGTTTCCCCTGG - Intergenic
1151755249 17:76072052-76072074 GATATCAGGCAGGTTTCCCCTGG - Intronic
1152363151 17:79841618-79841640 CATTGCAAACAGATTTTCCAGGG - Intergenic
1153972062 18:10235942-10235964 AATTTCAGAATGATTGCCCCCGG + Intergenic
1155915486 18:31553164-31553186 CATTTCAAAAAGATAGCCCCAGG + Intergenic
1156680548 18:39583433-39583455 TATTTTAGACAGATATCCCAGGG + Intergenic
1160030434 18:75252960-75252982 CATTTCAGTCAAATTACCCAAGG - Intronic
1161168459 19:2801202-2801224 CGCTTCATACAGACTTCCCCAGG - Intronic
1161878161 19:6927938-6927960 CATTTCAGGTACATTTGCCCAGG + Intronic
927136609 2:20101311-20101333 CCTTTCAGAGAGACTTTCCCTGG + Intergenic
927242526 2:20931258-20931280 AATTTCAGCCAGATCTGCCCAGG - Intergenic
927558553 2:24052539-24052561 CATTTCAGACAGAGTGGTCCAGG - Intronic
929531592 2:42756275-42756297 CTTGTCAGAAACATTTCCCCAGG + Exonic
932303647 2:70686315-70686337 CAATGCAGACAGATAACCCCGGG - Intronic
932373559 2:71213764-71213786 CATTTAAGACAAGTTTCTCCAGG + Intronic
932394973 2:71437699-71437721 CACTGCTGACAGGTTTCCCCAGG + Intergenic
936992559 2:118381729-118381751 CATTTCAGACAGAAATTTCCTGG + Intergenic
937547966 2:123048172-123048194 CGTTGCAGACAGATGGCCCCTGG + Intergenic
940421847 2:153488208-153488230 CATTTCAGTCAGGTTTGCCATGG - Intergenic
941490886 2:166140975-166140997 CATTTTAACAAGATTTCCCCAGG + Intergenic
941841806 2:170093227-170093249 GATTTCAGTGAGATTTTCCCAGG - Intergenic
943041059 2:182805738-182805760 CATTTCAGAGATAATTCTCCTGG - Intergenic
946958960 2:224962656-224962678 TAATTCAGAAAGATTTCCACAGG - Intronic
947049662 2:226027882-226027904 CATTTTAAAAAAATTTCCCCAGG + Intergenic
1169304898 20:4481213-4481235 GATTTCAGATAGCTTTCGCCTGG + Intergenic
1169341462 20:4799701-4799723 CTTTGTGGACAGATTTCCCCAGG - Intronic
1169573370 20:6930651-6930673 CTTCTCAGACACATTTTCCCAGG + Intergenic
1169843368 20:9963655-9963677 CCTTTCAGTCAGAAATCCCCTGG + Intergenic
1170272005 20:14537841-14537863 CATTTTAGACAGTCTTCCTCAGG + Intronic
1173626266 20:44475432-44475454 AATGACAGACAGATGTCCCCTGG + Intergenic
1175109592 20:56637834-56637856 CATTTCAGCCTGATTACCCACGG + Exonic
1177613117 21:23479789-23479811 CTGTTCACTCAGATTTCCCCAGG - Intergenic
1178425327 21:32474466-32474488 CATCTCAGAGAGGTTTCTCCAGG + Intronic
1179182241 21:39055225-39055247 CTATTCAGAAAAATTTCCCCAGG + Intergenic
1179529387 21:42008950-42008972 CATTTTAGAAAGATTTCTCATGG - Intronic
1179731268 21:43368595-43368617 CCTTTCACTCAGTTTTCCCCTGG - Intergenic
1180214511 21:46315847-46315869 CATTTCATACAGAGTGCCCTGGG + Intronic
1181884784 22:26011616-26011638 CATTTTAGTTAGATTTCCCAAGG - Intronic
1183076277 22:35429279-35429301 CATTTCAAAAAGATTTGGCCGGG - Intergenic
1183469818 22:37999281-37999303 CAGTTCAGACACATTTCTACCGG + Intronic
1184106919 22:42373093-42373115 CATTTCTGATTGATTTTCCCTGG + Intergenic
1184143205 22:42591863-42591885 CATCTCACAGAGACTTCCCCTGG + Intronic
949333202 3:2945287-2945309 AAATTCAGACAGATTCCTCCGGG - Intronic
950344671 3:12282126-12282148 AATTTCAGAGAGATTTCACTTGG - Intergenic
951126381 3:18989353-18989375 ATTTTGAGTCAGATTTCCCCAGG + Intergenic
955790666 3:62585846-62585868 CATTTCAACCTGATTTCACCTGG + Intronic
960400454 3:117191423-117191445 CATTTTAGCAAGATTCCCCCAGG + Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962184821 3:133247088-133247110 TATTTGAGACAGTTTTCCCCAGG - Intronic
962283872 3:134070995-134071017 CATTTCAGGCAGATTTCCTGAGG + Intronic
963462700 3:145637309-145637331 CATTTCAGACAGGTTTAGTCAGG + Intergenic
974455468 4:62124600-62124622 CATTTCAAGCAGATTTCCCTGGG + Intergenic
974583344 4:63836323-63836345 CAATTCAGACAGTTTTACCTTGG + Intergenic
975159687 4:71111208-71111230 CAGTACTGAGAGATTTCCCCAGG - Intergenic
979342370 4:119541457-119541479 TATTTGAAACAGATTTCCACTGG + Intronic
984206237 4:176791891-176791913 TATTTCAGACTGGTTTCCTCTGG - Intronic
984633344 4:182083873-182083895 GATTTCCTACAGATCTCCCCAGG - Intergenic
985116360 4:186595732-186595754 CACTTCAGACAGGCTTTCCCGGG + Exonic
987814489 5:22882699-22882721 TTTTTCAGACTGATTTCCCCAGG - Intergenic
989617422 5:43350793-43350815 CATTTCAGTCAGTTTTCACAAGG + Intergenic
991267592 5:64740219-64740241 TGTTTCAGAGAGATTTCTCCAGG - Intronic
996311137 5:122107248-122107270 CATCTCAGGCAGAATTCTCCAGG - Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
996895087 5:128471374-128471396 CATTTCAGTAAGATTTGCCTTGG + Intronic
997154347 5:131537253-131537275 TAATTCAGACAGATTTGCCCAGG - Intronic
997361988 5:133301015-133301037 GTTTTCAGACACATTTCACCTGG - Intronic
998588997 5:143457276-143457298 CAGTTCAAAAAGACTTCCCCAGG + Intergenic
1001809690 5:174618310-174618332 CACGTCAGTCAGACTTCCCCAGG - Intergenic
1004045578 6:12019620-12019642 CATTTCAGACTATTTCCCCCAGG - Intronic
1005716935 6:28558330-28558352 CTTTTCAAACATTTTTCCCCTGG - Intergenic
1006847668 6:37074096-37074118 CATTCCAGAGAGATTTCTTCTGG - Intergenic
1008348044 6:50453783-50453805 CATTTTAAACAGAATTCCCATGG - Intergenic
1008832350 6:55780933-55780955 CATTTCAGAGTGATGTCCCATGG - Intronic
1009018153 6:57925922-57925944 CATTTCAAAAAAACTTCCCCTGG + Intergenic
1009296694 6:61959346-61959368 CATTTCAGCCAGATTTCTTTTGG + Intronic
1009488433 6:64255267-64255289 CATTTCAGAAACCCTTCCCCTGG - Intronic
1010102707 6:72128164-72128186 CATTTCAAACAGATGGCTCCAGG + Intronic
1010284785 6:74063554-74063576 CATTTCAGAGAGATGAGCCCAGG - Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1013770046 6:113618290-113618312 CTTTTCAGAAAGATCTTCCCTGG + Intergenic
1014316020 6:119865665-119865687 CAATTTAGACAGTTTTGCCCTGG - Intergenic
1015534775 6:134256780-134256802 CATTTCAGACAGCACTCCTCGGG + Intronic
1016273096 6:142313574-142313596 ACTTTCAGAAACATTTCCCCTGG - Intronic
1016774692 6:147892478-147892500 CAGTACAGACAGAATTACCCAGG - Intergenic
1016781975 6:147968850-147968872 CATTTAAGACAAATTGCCCCTGG - Intergenic
1017443922 6:154490209-154490231 CCTTTCAGTGACATTTCCCCTGG + Intronic
1018257599 6:161937567-161937589 CATTTCAAACAGTTATCTCCTGG + Intronic
1018623571 6:165755395-165755417 CATTTCAAAGACATTTCCCCAGG - Intronic
1020863157 7:13520522-13520544 CATTTGAGATAGATTTCACCAGG + Intergenic
1020924249 7:14304594-14304616 CAGTTCACAGATATTTCCCCTGG + Intronic
1028207027 7:88030421-88030443 CTTTTCAGACAGATTTCAAAAGG - Intronic
1029192431 7:98781245-98781267 CCTTTGAGCCTGATTTCCCCAGG - Intergenic
1030332818 7:108290600-108290622 CATTTCCGACAGATTTCATGTGG + Intronic
1032027126 7:128452479-128452501 CAATTCAAACATATTTCCTCTGG - Intergenic
1033573626 7:142658419-142658441 CATTTCTGATAGATTTCCCCAGG + Intergenic
1034663670 7:152795780-152795802 CACTTCAGACAGAGTTGCACGGG - Intronic
1034745012 7:153516554-153516576 CATTTTAAACAGAATCCCCCAGG + Intergenic
1038133111 8:24756149-24756171 CATTTCACACAGAAGTCCTCAGG - Intergenic
1038659680 8:29486429-29486451 TTTTTCAGACAGAGTTGCCCAGG + Intergenic
1041277300 8:56175946-56175968 CAATTCAGACATATTTTCCTTGG + Intronic
1042581723 8:70286821-70286843 CCTTTCTCTCAGATTTCCCCGGG - Intronic
1043506107 8:80904649-80904671 CATTTCAGCAAGATCTTCCCAGG - Intergenic
1044814512 8:96097628-96097650 CATTTCAGAAAGGTGGCCCCTGG + Intergenic
1045280087 8:100742574-100742596 CATTTCTTTCAGTTTTCCCCAGG - Intergenic
1045650375 8:104336703-104336725 CATTTCAGAGTGATGTTCCCAGG - Intronic
1047880633 8:129189018-129189040 CATGTCAGACAGAATCCCACAGG + Intergenic
1048212936 8:132471148-132471170 CATTTCTGACAGATTCCCAGGGG - Intronic
1048697823 8:137048019-137048041 CATATCAGAGATATTTCACCTGG + Intergenic
1052560242 9:30076013-30076035 TATTTCAGACAAATGTCCACAGG + Intergenic
1052886226 9:33650798-33650820 CATTTCTGATAGATTACCCCAGG + Intergenic
1054361978 9:64131643-64131665 TATTTCAGACTGTTTTCCCTTGG - Intergenic
1057169593 9:92953539-92953561 CATTTTACACACATTTTCCCAGG + Intronic
1057849183 9:98551436-98551458 ACTTTCAGACAGATTACCCAAGG + Intronic
1058157317 9:101529879-101529901 ATTTTCAGAGAGCTTTCCCCCGG + Intronic
1058226924 9:102376384-102376406 TATTTCAGAACTATTTCCCCAGG + Intergenic
1060462191 9:123867416-123867438 CATGTAAGACTGATTTCCCCAGG - Intronic
1061703923 9:132437819-132437841 CATTTTAGAGAGATCACCCCGGG + Intronic
1061740817 9:132704552-132704574 CATCTTTGACAGGTTTCCCCAGG + Intergenic
1062152564 9:135029402-135029424 CACTACAGCCAGATGTCCCCTGG - Intergenic
1186129618 X:6452410-6452432 CACTACAGCCAGATTTGCCCTGG + Intergenic
1187258357 X:17661625-17661647 CATTTCAGATTATTTTCCCCAGG + Intronic
1187821308 X:23291014-23291036 AATTTCAGACAGGTTATCCCTGG + Intergenic
1196058648 X:111384181-111384203 CATTTCAGAAATATTGCCCTTGG + Intronic