ID: 996880147

View in Genome Browser
Species Human (GRCh38)
Location 5:128287829-128287851
Sequence CAACCAAGTCTGCTAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996880144_996880147 7 Left 996880144 5:128287799-128287821 CCAGAGGAAGGAGGGGAGGGAAT 0: 1
1: 0
2: 8
3: 58
4: 580
Right 996880147 5:128287829-128287851 CAACCAAGTCTGCTAAAGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 123
996880141_996880147 11 Left 996880141 5:128287795-128287817 CCATCCAGAGGAAGGAGGGGAGG 0: 1
1: 0
2: 3
3: 54
4: 559
Right 996880147 5:128287829-128287851 CAACCAAGTCTGCTAAAGAAAGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996880147 Original CRISPR CAACCAAGTCTGCTAAAGAA AGG Intronic
901546080 1:9958397-9958419 CAACAAAGCCTGCTAAATAATGG - Intronic
901744198 1:11361840-11361862 CAACCAGCTCTGCTAGAGGAAGG + Intergenic
902276679 1:15345046-15345068 TAACCATGTCTGTTAAACAATGG + Intronic
904146037 1:28392259-28392281 CAACCAAGTCTGCTACTAAAGGG - Intronic
904889225 1:33765923-33765945 GAACCAGGTCGGCTGAAGAAAGG + Intronic
904906622 1:33902115-33902137 CAAGCAAGTCTTCTGAAGCAGGG + Intronic
906323539 1:44830817-44830839 CAACCAGGTCTGCCAGGGAAAGG - Intronic
908991568 1:70097409-70097431 TAACCAATTCTGCTAAAATAAGG - Intronic
909323346 1:74317996-74318018 CAACTATGTCTTCTCAAGAAAGG + Intronic
910099017 1:83556724-83556746 CAAGCAAGGCAGCTAAAGCAAGG + Intergenic
910560199 1:88581944-88581966 CAACCAAGGCAGCTAAGGGAGGG + Intergenic
917770326 1:178270004-178270026 CAACCAAGTGTGAGAAAAAAAGG - Intronic
919394272 1:197024670-197024692 CAGCCAAGTGTTGTAAAGAAAGG + Intergenic
921055948 1:211542618-211542640 CACCCAAGGGTGCTAAATAATGG + Intergenic
921072087 1:211669272-211669294 CAACCAAATCTGCTATTAAAGGG + Exonic
1065820662 10:29522409-29522431 AAACCATGTCTATTAAAGAAAGG - Exonic
1070703602 10:78621102-78621124 AAACCAAGTCCACTAAAAAATGG - Intergenic
1072525860 10:96271002-96271024 CAACCAACTTTTCTAAGGAAGGG - Intronic
1072983569 10:100119946-100119968 CAAGCAAGTCTGATACACAATGG + Intergenic
1073374798 10:103023733-103023755 CAACAAAGTCAGCAAAAGGATGG + Intronic
1074440884 10:113476622-113476644 CAACCAGGACTTCTAAAGATTGG - Intergenic
1076144205 10:128104159-128104181 CAACCAGGTCTTCTAGAGCACGG + Exonic
1077002289 11:330301-330323 CCACCACGGCTGCTGAAGAAAGG - Intergenic
1081479884 11:43476225-43476247 CTACCAAGTCTGGGAAAGCAAGG + Intronic
1088194218 11:107257712-107257734 CAACCATGTCAACTATAGAACGG + Intergenic
1090600694 11:128367493-128367515 GAACAAATTCTGCTAAAGAGGGG + Intergenic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1093900615 12:24627181-24627203 CAACAAAGTCACCTAAAGCATGG + Intergenic
1094307089 12:29032409-29032431 GAACCAAGTCTGAAGAAGAAGGG - Intergenic
1095545372 12:43362012-43362034 CAACCTAGTCTGCTAATACAAGG - Intronic
1096952850 12:55492782-55492804 CAACAAAGTGTGCAAAACAATGG + Exonic
1097360118 12:58650272-58650294 CAACCAATTATGCTTAAAAATGG - Intronic
1099652754 12:85449487-85449509 CAAGCAAATGTCCTAAAGAAAGG - Intergenic
1099681327 12:85832381-85832403 CAACCAAGTGTTCCAAAAAATGG + Intronic
1101291203 12:103371455-103371477 CAAAAAAGTCTTATAAAGAAGGG - Intronic
1106296060 13:28414854-28414876 CAATCAAGTGTGCTGAAAAAGGG + Intronic
1108334630 13:49427030-49427052 GGAGCAAGTATGCTAAAGAAAGG - Intronic
1108557328 13:51607281-51607303 CAAGCAAGTCTACTAAAGGAAGG - Intronic
1109201693 13:59438346-59438368 CAACTCAGGCTGCTAAAGATTGG + Intergenic
1109981872 13:69919393-69919415 AAACCATGTCAGCTAAAAAAAGG - Intronic
1111129015 13:83950113-83950135 AAAACAAGTTTGCAAAAGAATGG + Intergenic
1114043215 14:18699159-18699181 CAACCAAATCTGCTATTAAAGGG + Intergenic
1114047506 14:18889605-18889627 CAACCAAATCTGCTATTAAAGGG + Intergenic
1114116708 14:19629803-19629825 CAACCAAATCTGCTATTAAAGGG - Intergenic
1114815525 14:25953539-25953561 CAGGCAAGTCATCTAAAGAAAGG - Intergenic
1116502758 14:45640067-45640089 CAATAAAGTAAGCTAAAGAAAGG - Intergenic
1119927738 14:78512343-78512365 CAACAAAGGCTGATACAGAAAGG + Intronic
1127224019 15:56911777-56911799 CAACCAAACCTGCAAAAGAATGG + Intronic
1129005464 15:72369363-72369385 CAACAAAGTCAGCTGAAGAAAGG - Intronic
1129826459 15:78637986-78638008 CAAACAAACATGCTAAAGAAGGG - Intronic
1131400191 15:92119153-92119175 CAGCCAAGTCTCCTAAATTATGG - Intronic
1133571336 16:7043209-7043231 CAACCCAGCCTGCTGAAGGACGG - Intronic
1134601808 16:15539457-15539479 CAACTAAGTCTGATAAAGCAGGG - Intronic
1134796782 16:17046810-17046832 CAACCAATTAGGCAAAAGAAAGG - Intergenic
1135210411 16:20521323-20521345 CAACCATGTCTGCCAGATAAAGG + Intergenic
1135486932 16:22873925-22873947 CAGGCAAGCCTGCTGAAGAATGG - Intronic
1137354845 16:47751412-47751434 CAACCAAGTCTGCATTTGAAAGG + Intergenic
1143877980 17:10007314-10007336 TAACCAAGACGTCTAAAGAATGG + Intronic
1144132109 17:12256008-12256030 CAACGAAATATGGTAAAGAAGGG - Intergenic
1144165380 17:12605145-12605167 CAATCAAGTGTCCTAAGGAAAGG + Intergenic
1145130360 17:20340900-20340922 CCACCAGATTTGCTAAAGAAGGG + Intergenic
1146743975 17:35312214-35312236 CAACCAAATCTACAAAAGATTGG - Intergenic
1155915571 18:31553906-31553928 GCACCAAGTCTGCTACAGGATGG - Intergenic
1156992908 18:43431625-43431647 CAACCAATTCTGTTAGAGAATGG + Intergenic
1159269634 18:66131707-66131729 CAACAAACTGTGCCAAAGAATGG + Intergenic
1165570969 19:36774823-36774845 CAGCTAGGTCTGCTAAAGCAAGG + Intronic
925715529 2:6781332-6781354 AAACAAAGGCTGCTAAAGAAGGG + Intergenic
926024013 2:9524076-9524098 CAATCAAGTAAGCTAGAGAAAGG - Intronic
927393441 2:22622438-22622460 CAGCCTCATCTGCTAAAGAAAGG + Intergenic
928734844 2:34276249-34276271 CAGCAAAAACTGCTAAAGAAAGG + Intergenic
929750996 2:44713692-44713714 CAATTAGGTCTGCTAATGAAGGG - Intronic
929975846 2:46633836-46633858 CAAGCAAGTATTATAAAGAAAGG + Intergenic
934726909 2:96627749-96627771 CAATCAAGTCAGGGAAAGAATGG + Intronic
937047750 2:118861038-118861060 CAGCCAAGTGTGCATAAGAAAGG - Intergenic
938424881 2:131178127-131178149 CAACCAAATCTGCTATTAAAGGG + Intronic
940424451 2:153514778-153514800 CAACCAAGTATCCAAAAGCATGG - Intergenic
945005113 2:205396949-205396971 CCACAAAGGCTGCTACAGAAAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169070060 20:2720436-2720458 AACCCAAGTCATCTAAAGAAAGG - Intronic
1180466039 22:15612276-15612298 CAACCAAATCTGCTATTAAAGGG + Intergenic
1181880573 22:25976355-25976377 CAACCAATTCCACTAAAAAATGG + Intronic
949179400 3:1110278-1110300 TATCCAACTCTGCTAAACAATGG + Intronic
950017154 3:9762320-9762342 CATCCAAGTTTTCTACAGAAGGG + Intronic
955779435 3:62468580-62468602 CAACCATGTCTCCTTATGAAAGG - Intronic
956561666 3:70583929-70583951 CAAACATGTCTGCTCAAGGAAGG + Intergenic
960771476 3:121197010-121197032 TAAGCAAGTATGTTAAAGAAAGG - Intronic
960855466 3:122098023-122098045 GCACCAAGTCTGCTGTAGAAAGG + Intronic
966174263 3:177118587-177118609 CAACTAAGCCTCATAAAGAAGGG - Intronic
970412111 4:15818490-15818512 ACACCAACTCTGCTAAAGGACGG + Intronic
976848229 4:89514510-89514532 CAACGAAATCTTTTAAAGAATGG + Intergenic
980696913 4:136369264-136369286 CAACCATGACTTCTATAGAAAGG + Intergenic
981780921 4:148427968-148427990 AAACAAAGTCTGATGAAGAATGG + Intronic
983072968 4:163291744-163291766 AAACCTGGTCTGTTAAAGAAAGG + Intergenic
983075898 4:163326290-163326312 CAAGCAAGTCTGAGAAGGAAAGG + Exonic
985093777 4:186391769-186391791 CAAGCAAGTCTTATAAAGAAGGG + Intergenic
988334461 5:29887854-29887876 CATACCAGTCTGCTTAAGAATGG - Intergenic
989266051 5:39475189-39475211 CCACCAACTCTGCTAAAGCCTGG - Intergenic
990973834 5:61539787-61539809 CATCAAAGACTGCTAAATAAAGG + Intronic
991408749 5:66326657-66326679 CAAACAACCCTGCAAAAGAAAGG + Intergenic
991986848 5:72297255-72297277 CAAGAAAGTCTGTAAAAGAATGG - Intronic
991989332 5:72321582-72321604 CAGCCAAGGATCCTAAAGAAAGG + Intronic
996880147 5:128287829-128287851 CAACCAAGTCTGCTAAAGAAAGG + Intronic
997792273 5:136771613-136771635 CAACCACATCTGCTAATGAGGGG - Intergenic
1000146264 5:158456019-158456041 CAAGAAAGTCAGCTATAGAAAGG + Intergenic
1002630749 5:180574598-180574620 CAAACAAGTCTGAAAAAGGAGGG - Exonic
1008136995 6:47788445-47788467 CAAGCAAGTCGGCTCTAGAATGG + Intronic
1008332555 6:50261272-50261294 CAACTTAATCTGCTAAAGCATGG + Intergenic
1009781038 6:68270987-68271009 AAACAAACTCTGCCAAAGAAAGG + Intergenic
1016070115 6:139728457-139728479 CAACCAAATTTGCCAAGGAAAGG - Intergenic
1020391651 7:7664498-7664520 AAATCAAGACTGCAAAAGAAGGG - Intronic
1021299242 7:18951480-18951502 CAAGCAATTCTGTTAAATAATGG - Intronic
1021490787 7:21218472-21218494 CAACCCTGTCTGCTGAAGAGAGG + Intergenic
1022400740 7:30034542-30034564 CAATAAAGTAAGCTAAAGAAAGG + Intronic
1027613972 7:80398741-80398763 CAACCTATTATGCAAAAGAATGG + Intronic
1030085259 7:105810420-105810442 CAATAATGTCTGCTATAGAAAGG + Intronic
1030964139 7:115968568-115968590 CAACCACGTCTCTGAAAGAAAGG + Intronic
1031353136 7:120760119-120760141 CAAATAAGTCTGAAAAAGAATGG + Intergenic
1034724496 7:153322765-153322787 CAACCAACTATGCTTAAGTATGG - Intergenic
1037174229 8:15928460-15928482 AAACCAAGTATTCTAAAGAAAGG + Intergenic
1040896011 8:52369036-52369058 CAATCACGTTTGCTAAAAAAAGG + Intronic
1041450110 8:57996596-57996618 CAACCAGGTCTCCTTATGAAAGG - Intronic
1042092813 8:65177629-65177651 CAGCCAAGTTTCCTAAAGAGAGG - Intergenic
1047663521 8:127064775-127064797 CAACCAAGTCTGGTAAGAACAGG + Intergenic
1048924357 8:139257939-139257961 CAACCAAATTTGCTAGAAAAGGG - Intergenic
1186467863 X:9797878-9797900 TAACCAAGGCAGTTAAAGAAAGG - Intronic
1186812600 X:13204997-13205019 CAATAAAGTAAGCTAAAGAAAGG + Intergenic
1192938362 X:75885238-75885260 CAACCATGTCTGCTATTGAGAGG + Intergenic
1193504134 X:82319109-82319131 GAACAAACTGTGCTAAAGAAAGG + Intergenic
1194805370 X:98320362-98320384 CAACCAACCCTGTTAAAAAATGG - Intergenic
1196669555 X:118350975-118350997 CTACCATGTCTGCGGAAGAAGGG + Intronic
1197166872 X:123387421-123387443 CAACCAAGTAGGAAAAAGAAAGG - Intronic
1198892603 X:141415195-141415217 GAACAAAGTCTATTAAAGAAAGG + Intergenic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic
1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG + Intergenic
1202170416 Y:22037850-22037872 AAAGCCAGTCTGCTAAAGAAAGG + Intergenic
1202220948 Y:22548523-22548545 AAAGCCAGTCTGCTAAAGAAAGG - Intergenic
1202322164 Y:23647140-23647162 AAAGCCAGTCTGCTAAAGAAAGG + Intergenic
1202548604 Y:26022916-26022938 AAAGCCAGTCTGCTAAAGAAAGG - Intergenic