ID: 996883719

View in Genome Browser
Species Human (GRCh38)
Location 5:128330861-128330883
Sequence TTTGGCCCACATTTATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996883719 Original CRISPR TTTGGCCCACATTTATAGCC TGG (reversed) Intronic
902492762 1:16797218-16797240 TTGGGCCCACAGTTTCAGCCAGG + Intronic
904001975 1:27343786-27343808 TTTGGCACACATACATTGCCCGG - Intronic
904609075 1:31715267-31715289 TTTGGACCACACTCATGGCCGGG + Intergenic
913967776 1:143391423-143391445 TTTGGCCGACATTTGTAGTGGGG - Intergenic
918311479 1:183288502-183288524 TCTGGCCCAGACTTATACCCTGG + Intronic
919495083 1:198255138-198255160 CTGGGCTCATATTTATAGCCTGG - Intronic
919839127 1:201596580-201596602 TTTGGCCCAGACTTAGTGCCTGG + Intergenic
923527685 1:234785314-234785336 TTGGGCCCACAGTTTCAGCCAGG - Intergenic
924257750 1:242199170-242199192 TGTGGCTCACATTCATGGCCTGG + Intronic
1065750002 10:28877264-28877286 TTTGGCCCACTTTAAGTGCCAGG - Intronic
1076450368 10:130553109-130553131 TTTTGCCCACACTTACAACCAGG - Intergenic
1081952053 11:47052913-47052935 CTGGGCCCAGATTTATACCCAGG + Intronic
1084881417 11:72174198-72174220 GTTGGGCCACTTCTATAGCCAGG + Intergenic
1092107271 12:5930726-5930748 TTGGGCCCAAATTTTAAGCCTGG - Intronic
1093911687 12:24755066-24755088 TTTGTCACACATTAAAAGCCTGG + Intergenic
1109647600 13:65279706-65279728 TTTGGCCCAAATTTTCAGCCTGG + Intergenic
1112946802 13:104938247-104938269 TTTGGACCTCATTTAAATCCAGG - Intergenic
1117605905 14:57428895-57428917 TTTGGCCAACATATTTAGCATGG - Intergenic
1118458652 14:65967923-65967945 TTTGACCCACATTTATTGGGTGG - Intronic
1124602402 15:31145993-31146015 TGAGGCCCACATTCAAAGCCTGG - Intronic
1126407650 15:48337845-48337867 TTTGACCCTTATTTAGAGCCTGG - Intronic
1132788091 16:1669374-1669396 TTTGGCAAGCATGTATAGCCTGG + Intronic
1136239039 16:28933016-28933038 TTTGGCCCACACATACAGCTTGG - Exonic
1140215366 16:73003053-73003075 GTTTTCCCACATTTATAACCAGG + Intronic
1140224078 16:73064924-73064946 TTTGCACCACATGTAAAGCCTGG + Intergenic
1140707747 16:77646591-77646613 TTTGAGCCCCATATATAGCCTGG + Intergenic
1140772357 16:78216695-78216717 TTTGGCCCACCTAGATAACCAGG + Intronic
1146318915 17:31831238-31831260 TGTGGCCCAGCTTTATAGGCGGG - Intergenic
1147344347 17:39778835-39778857 ATGGGCCCACATTCATAGGCAGG - Intronic
1147747633 17:42705051-42705073 TTTGGCCCACATTCTTACTCGGG - Intronic
1151323558 17:73365683-73365705 CTTGTCCCACACTCATAGCCCGG - Intronic
1154002365 18:10493334-10493356 TTTGCCCCAGAATTTTAGCCTGG + Intergenic
1155069508 18:22301837-22301859 TCTGTCCCATATTTATAACCGGG + Intergenic
1156484560 18:37456644-37456666 CTTAGCCCCCATTTATAGCTGGG + Intronic
1157877240 18:51285361-51285383 TTTGGCCCACAATGAGAGTCTGG + Intergenic
1159143732 18:64427241-64427263 TCTGGCACACATTTAAAGCAGGG + Intergenic
1164456096 19:28408282-28408304 TTTGGCCCACATCCCTAACCTGG + Intergenic
1202701563 1_KI270712v1_random:168891-168913 TTTGGCCGACATTTGTAGTGGGG - Intergenic
930337072 2:50061584-50061606 TTTGGACCCTTTTTATAGCCCGG - Intronic
934172479 2:89552338-89552360 TTTGGCCGACATTTGTAGTGGGG - Intergenic
934282792 2:91626690-91626712 TTTGGCCGACATTTGTAGTGGGG - Intergenic
935068245 2:99670671-99670693 TTTGGCCTATAATTATAACCTGG - Intronic
944914688 2:204346317-204346339 TTTGGCCCAGATTCAGAGTCTGG - Intergenic
1169361975 20:4957936-4957958 TTTGGCAGACACTTAAAGCCTGG + Intronic
1179909735 21:44441445-44441467 TTTAGCCCGCATTTAAAGCCCGG - Intronic
962538341 3:136351775-136351797 TTTGACCCACATTTTAGGCCAGG - Intronic
966628395 3:182044916-182044938 TTTGGTCAACATTTATTGCATGG + Intergenic
967018540 3:185502855-185502877 ACAGTCCCACATTTATAGCCTGG + Intergenic
967500203 3:190188444-190188466 TCAGGCCCACATTTTTATCCTGG + Intergenic
979388450 4:120098550-120098572 TCTGGCCTACATGTATAGTCTGG + Intergenic
980545509 4:134256388-134256410 TTTGGCACACTTTTAGACCCTGG + Intergenic
982788664 4:159565166-159565188 TTTGGCCAATATCTAAAGCCTGG - Intergenic
990194859 5:53303160-53303182 GTGGGCCCAGATTGATAGCCTGG + Intergenic
990311149 5:54540030-54540052 TTTGGGACTCATTTTTAGCCAGG - Intronic
993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG + Intergenic
993346010 5:86783440-86783462 TTTGGCCCCCTTTTATATCTTGG - Intergenic
996883719 5:128330861-128330883 TTTGGCCCACATTTATAGCCTGG - Intronic
999853970 5:155573223-155573245 TTTGGCTCCCATTTATGGCAAGG - Intergenic
1003488059 6:6596629-6596651 TTTGGCCCAAATTTAAAGAGAGG + Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1015253011 6:131146841-131146863 TTTGATGAACATTTATAGCCAGG + Intronic
1023138153 7:37074691-37074713 TTAACCCCACATTCATAGCCGGG - Intronic
1023733941 7:43218604-43218626 TTTGGGCAACATTTATACCTAGG + Intronic
1027623601 7:80521981-80522003 CTTAGCTGACATTTATAGCCAGG - Intronic
1033646305 7:143307213-143307235 TTCTGCCCTCATTTACAGCCTGG - Exonic
1038095824 8:24308699-24308721 TTTGGGGGAAATTTATAGCCTGG + Intronic
1040355231 8:46610838-46610860 TCTGGGACACATTTAAAGCCGGG + Intergenic
1040709928 8:50175892-50175914 ATTTGCCCACATTTAAAGCTAGG + Intronic
1042408250 8:68431085-68431107 TTTGACCTGGATTTATAGCCTGG - Intronic
1042579710 8:70263359-70263381 TGTGGCCCAAATTTATTGCATGG - Intronic
1043734366 8:83724824-83724846 ATTGACCCTCATTTATAGGCAGG - Intergenic
1044345808 8:91103062-91103084 TTTGGCCCACATCTGGAGTCAGG + Intronic
1046302522 8:112315178-112315200 TTTGGGCTACATTTATGGGCTGG - Intronic
1052849280 9:33366697-33366719 CTTGGCCCAAGTTTATGGCCTGG + Exonic
1054854686 9:69885745-69885767 TTTGACCCACATTCTTTGCCAGG - Intronic
1058427616 9:104889031-104889053 TTTAGCCCACGTTAATTGCCTGG + Intronic
1198233330 X:134714144-134714166 CTTGGGCCACAGCTATAGCCTGG - Intronic
1199506970 X:148573886-148573908 TTTGCCCCACATTTCTAGTTTGG - Intronic