ID: 996884276

View in Genome Browser
Species Human (GRCh38)
Location 5:128337725-128337747
Sequence GAGCCCTGTGGAAGTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996884276_996884283 20 Left 996884276 5:128337725-128337747 CCACAAGGACTTCCACAGGGCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 996884283 5:128337768-128337790 GTGGCTTGTTATAAAAAAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 224
996884276_996884281 1 Left 996884276 5:128337725-128337747 CCACAAGGACTTCCACAGGGCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 996884281 5:128337749-128337771 TCACACAGGGACCAATCACGTGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996884276 Original CRISPR GAGCCCTGTGGAAGTCCTTG TGG (reversed) Intronic
901420140 1:9145189-9145211 GAGCCCTGTGGAAGGCCGCTGGG + Intergenic
901853995 1:12032378-12032400 GGGCTCTCTGGAAGTCCCTGGGG + Intergenic
901988156 1:13092088-13092110 GAGCCCTGTGCAAGTGCTGCTGG + Intergenic
901993656 1:13134679-13134701 GAGCCCTGTGCAAGTGCTGCTGG - Intergenic
902405749 1:16182442-16182464 GAGCCCTGTGGCCTTCCTGGAGG + Intergenic
904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG + Intergenic
905046999 1:35012537-35012559 ATGCCCTGGGGAAGTCATTGAGG - Exonic
908104257 1:60825132-60825154 CAGGCCTGTGGAAATCCTTGTGG + Intergenic
909258108 1:73450236-73450258 AACCCCTGTGGAAGTCAGTGTGG + Intergenic
910066525 1:83159107-83159129 GAGCCATTTGAATGTCCTTGAGG - Intergenic
910281133 1:85502843-85502865 GAGCCATGGGGAAGCCCTGGAGG + Intronic
912177213 1:107174540-107174562 GAGCACTTTGGAAGTCTTGGTGG - Intronic
912593185 1:110848382-110848404 GAGGCATGTGGAATTCCTTGTGG - Intergenic
914696955 1:150092441-150092463 GAGAACAGTTGAAGTCCTTGAGG + Intronic
916240917 1:162638583-162638605 TCGCACTTTGGAAGTCCTTGTGG + Intronic
917449559 1:175135895-175135917 GAGCTATGTGGAAGGCTTTGGGG + Exonic
917509106 1:175655566-175655588 GAGTGCTGTGGGAGTCCTGGTGG + Intronic
921206859 1:212857041-212857063 GCGCCCTTGGGAAGCCCTTGTGG + Intergenic
1063404149 10:5776539-5776561 GAGGCATGTGGAATTCCTTGTGG + Intronic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1064242762 10:13646045-13646067 GAGACCTGTGGGAGTCGTAGAGG - Exonic
1067548022 10:47210158-47210180 GACCCTTGTGGAAGTCAGTGTGG + Intergenic
1067700365 10:48567213-48567235 GAGCCCTGCAGAAGACCCTGTGG + Intronic
1067770158 10:49116741-49116763 GAGACCTCTGGAAGTGCCTGGGG - Intergenic
1068050312 10:51942023-51942045 AACCCTTGTGGAAGTCCGTGTGG - Intronic
1068991314 10:63153891-63153913 GAGGCATGTGGAATTCCTTGTGG + Exonic
1069087260 10:64155499-64155521 GAGGCCTCTGGAAGTCTTTAGGG + Intergenic
1071208734 10:83313614-83313636 CAGTCCTCTGAAAGTCCTTGTGG + Intergenic
1072974311 10:100044312-100044334 GTGACATGTGGAAGGCCTTGGGG + Intronic
1073826290 10:107326686-107326708 AAGCCTTGTGGAAGTCAGTGTGG + Intergenic
1074300348 10:112227515-112227537 CAGCCCTGTGGAAGGCCTAGTGG - Intergenic
1074955334 10:118383282-118383304 GATCCCTGGGGAAGTACCTGTGG + Intergenic
1075544534 10:123344976-123344998 GGGCCCTAAGAAAGTCCTTGAGG - Intergenic
1075632963 10:124012195-124012217 GAGGCCTGGGGATGTCCTTCAGG - Intronic
1078084583 11:8225962-8225984 TAGCCCTGTGGGAGTCCCTGGGG - Intronic
1078222893 11:9365931-9365953 GTGCCCTGAGGACCTCCTTGAGG - Intergenic
1079080173 11:17408454-17408476 CAGACCTCTGGAAGTCCTTGAGG + Exonic
1079167480 11:18059160-18059182 AACCCCTGTGGAAGTCAGTGTGG + Intergenic
1085475814 11:76788273-76788295 GTGCCCTGTGGAAGTTGTCGAGG + Intronic
1085970335 11:81581953-81581975 GAGCCCTGAGGAAGGCCTGCAGG - Intergenic
1086465984 11:87053653-87053675 GTGCCCAGTTTAAGTCCTTGGGG - Intronic
1087368265 11:97248824-97248846 GATGCCTGTGGGATTCCTTGTGG + Intergenic
1087571552 11:99933464-99933486 GAGCACTGGGGAACTTCTTGTGG - Intronic
1088742010 11:112774905-112774927 GAGGCCTGTGGGAATCCTGGAGG - Intergenic
1090047781 11:123351205-123351227 AAGCCATTTGGAAATCCTTGAGG + Intergenic
1090184241 11:124725783-124725805 GAGCCCAGTGGACGTGCATGTGG - Intergenic
1092132027 12:6119402-6119424 GAGCCCTGGGGAGGTCAGTGTGG - Intronic
1092672689 12:10882248-10882270 TGCCCCTGTGGAGGTCCTTGTGG + Exonic
1092677005 12:10931027-10931049 TGCCCCTGTGGAGGTCCTTGTGG - Exonic
1092706988 12:11295778-11295800 GACCCTTGTGGAAGTCAGTGTGG + Intergenic
1093879915 12:24392553-24392575 GAGACCAGTGAAAGTTCTTGAGG - Intergenic
1094292999 12:28873104-28873126 GACCCCTGTAGAAGTAGTTGAGG + Intergenic
1094402961 12:30082550-30082572 CAGCCCTGTGGTAGACCTAGAGG + Intergenic
1096603020 12:52743591-52743613 GAGCACTGAGGGAGTCTTTGGGG - Intergenic
1097725200 12:63067162-63067184 GAGCCCAGTGGAAGCCCATAGGG + Intergenic
1098863069 12:75731768-75731790 AACCCTTGTGGAAGTCATTGTGG + Intergenic
1100715749 12:97303388-97303410 GTGGCATGTGGAAGGCCTTGTGG + Intergenic
1101005045 12:100393253-100393275 GATCCCTGTGGAAATCCCTGTGG - Intronic
1101175826 12:102150771-102150793 GAGATCTGTGGACGTCTTTGGGG + Intronic
1101268771 12:103120309-103120331 GAGCATTGTGGAAGGCCTTATGG + Intergenic
1102326841 12:111993065-111993087 GACCGCTGTGGAGGTCCGTGAGG - Intronic
1102505815 12:113384139-113384161 CAGCCCTGTGGAAGTATGTGCGG + Exonic
1105039887 12:132954184-132954206 AAGCCCTGTGGGAGTCACTGAGG - Intronic
1106612797 13:31299720-31299742 TATCCCTGTGGACTTCCTTGAGG - Intronic
1109983108 13:69936836-69936858 GAGGCCTCTGGAGGTTCTTGAGG - Intronic
1111322226 13:86646178-86646200 GACCCTTGTGGAAGTCAGTGTGG - Intergenic
1111725019 13:91996274-91996296 GAACCCTGTTGGAGTCCTAGTGG - Intronic
1112393262 13:99004135-99004157 GAGCCCTGCGTAGGTGCTTGTGG + Intronic
1115136550 14:30116099-30116121 GAGTCCTGTGGTAGTGCTTCAGG + Intronic
1115779301 14:36751585-36751607 GAGGATTGTGGAAGTCCTTGGGG - Intronic
1116170751 14:41398965-41398987 GAGCACAGTGGAAGACTTTGGGG - Intergenic
1117900861 14:60531314-60531336 GAGCCATGTGGGACTCCTTTGGG - Intergenic
1118052657 14:62046024-62046046 CAACCCTGTGGAAGTCAGTGTGG - Intronic
1121450076 14:94001397-94001419 TAGCCCTGGGGAAGGCCTAGAGG + Intergenic
1121497401 14:94403419-94403441 GAGCCATGTTGAAGACCTTGAGG + Intergenic
1122977208 14:105175752-105175774 GTGCCCAGGTGAAGTCCTTGAGG + Intronic
1123792611 15:23737377-23737399 GGGTGCTGTGGAGGTCCTTGTGG - Intergenic
1129394423 15:75236275-75236297 GTGGCCTGTGGAAGGGCTTGGGG - Intergenic
1129726779 15:77905527-77905549 GACCCCTCTGGAGGTACTTGGGG - Intergenic
1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG + Intergenic
1131867857 15:96731251-96731273 GAGCCCTGTGGAAATTTTTGAGG - Intergenic
1132582743 16:693086-693108 GAGACATTTGGAAGTCCTGGGGG - Exonic
1134026524 16:10958239-10958261 GTGCCCTGGGGGAGTCCCTGAGG + Intronic
1134809920 16:17158572-17158594 TGGACTTGTGGAAGTCCTTGGGG + Intronic
1136858669 16:33681252-33681274 GTGCCCTGTGGAACGCTTTGTGG - Intergenic
1137006670 16:35282245-35282267 GACCACTGTGGAAGTCAGTGTGG + Intergenic
1137545040 16:49396819-49396841 GAGCCCTGGAGCAGTCCTTTGGG - Intronic
1138266246 16:55661855-55661877 CAGCCCTTTGGGAGCCCTTGTGG + Intronic
1141874799 16:86816430-86816452 GAGCCCTGTGGCAAGCCATGAGG + Intergenic
1203120242 16_KI270728v1_random:1529747-1529769 GTGCCCTGTGGAACGCTTTGTGG - Intergenic
1143497707 17:7321864-7321886 GAGGGCTGAGGAAGTCTTTGAGG - Exonic
1144114939 17:12078845-12078867 TAGTCCTGTGGAAGCCATTGTGG + Intronic
1144744377 17:17603915-17603937 GAGCCTTGTGGAAATGGTTGTGG - Intergenic
1146354680 17:32124127-32124149 GAGCCCTGTGAAACTTCCTGTGG - Intergenic
1146677619 17:34784405-34784427 GAAGCCACTGGAAGTCCTTGAGG + Intergenic
1146945757 17:36872331-36872353 GAGCCCTTTGCAACTGCTTGAGG + Intergenic
1147549820 17:41432781-41432803 GTACCCTATAGAAGTCCTTGGGG + Intergenic
1150722666 17:67626751-67626773 GAGCCCTGTGGCAGCAATTGTGG + Intronic
1153335146 18:3916071-3916093 AAGCCTTATGGATGTCCTTGGGG - Intronic
1156301747 18:35842297-35842319 GAGGCATGTGGAATTCCTTCTGG + Intergenic
1156370987 18:36471029-36471051 GAGCCATGTGGGAGTAATTGTGG - Intronic
1156425929 18:37012486-37012508 GAGCTCTGTGGAAGTCAATTAGG - Intronic
1156736859 18:40270473-40270495 GAGCACTGTGGTAGACATTGTGG - Intergenic
1157444801 18:47736642-47736664 GAGCACTGTGCTAGACCTTGAGG - Intergenic
1161041893 19:2114767-2114789 GAGCCCTGTAGGGGTCGTTGGGG + Exonic
1162380411 19:10328617-10328639 GAGCCCTGTGGAGAGCATTGGGG - Intronic
1165306395 19:35005383-35005405 GAGCCCTGTGGATGTGGATGTGG + Intronic
1165921054 19:39298099-39298121 CAGGCCTGTGTGAGTCCTTGGGG + Exonic
1166852161 19:45766207-45766229 GAGCCTTGTGGTGGGCCTTGGGG + Intronic
1167114543 19:47480910-47480932 GAGCCCTGTGGGATTCACTGTGG - Intronic
924965668 2:74143-74165 GAGGCCTGAGGAAGCCCCTGTGG - Intergenic
925048575 2:793431-793453 GAGCCCTTGCGAGGTCCTTGGGG + Intergenic
925774507 2:7321070-7321092 GGGCCTTGTGGAAGTCAGTGTGG - Intergenic
925912846 2:8584340-8584362 GAGGCCTGTGGAAGTCACCGAGG - Intergenic
926043541 2:9693307-9693329 GAGGCCTGTGCCAGTCCCTGCGG + Intergenic
927451146 2:23210494-23210516 GAGGCCTGAGGAAGCCCTTGGGG + Intergenic
928280345 2:29940823-29940845 GAGCCCTTTGGCTGACCTTGAGG + Intergenic
929823165 2:45289622-45289644 GAGCCCTGAGAAGGACCTTGTGG - Intergenic
931043288 2:58322191-58322213 GAGGCCTGTTGAAGTACTTCCGG - Intergenic
934777522 2:96948883-96948905 GAGCCCAGTGGGACTCCTGGGGG + Intronic
935071270 2:99696001-99696023 GAGCCCTGTTGGAGTGGTTGGGG - Intronic
935703709 2:105837563-105837585 GAGCACTGTGCATGTCCCTGAGG + Intronic
936038120 2:109128854-109128876 GAGCCCTGGAGATGTCCTAGGGG + Intergenic
936524593 2:113234180-113234202 TATCCCTGTGGAAGCCCTTGAGG + Intronic
936620932 2:114096867-114096889 GAGCATTGTGGAAGTCAGTGTGG - Intergenic
941496388 2:166209876-166209898 AACCACTGTGGAAGTCCGTGTGG + Intronic
941794493 2:169584640-169584662 GGGCCCAGAGGAAGTCCCTGAGG + Intronic
945501752 2:210584234-210584256 TAGCCCTGTGGAAGCCTATGTGG + Intronic
947716717 2:232343577-232343599 GAAGCATGTGGAATTCCTTGTGG + Intronic
948261379 2:236606755-236606777 GAGCACAGTGGAAGCCCTTAGGG - Intergenic
948653286 2:239462320-239462342 GAGCCCTGGGGATGGCCCTGGGG + Intergenic
949000351 2:241609861-241609883 GAGCCCCGTGGCAGTCGCTGTGG - Intronic
1169949520 20:11027773-11027795 GAGTCCTGTGGGAGGCCCTGGGG + Exonic
1170032366 20:11956551-11956573 GTGCCCCGTGCAGGTCCTTGGGG - Intergenic
1170583440 20:17716163-17716185 GAGCCCTGTGGAAGCTCTTGAGG + Intronic
1172122046 20:32604196-32604218 GAGGCCTGTGGATGCCCTTGAGG + Intronic
1172851568 20:37970133-37970155 AAGCCCTGTGCTAGTCATTGGGG - Intergenic
1175152570 20:56946636-56946658 CTCCCCTGTGAAAGTCCTTGAGG - Intergenic
1175570085 20:60011827-60011849 GGTCTCTGTGGATGTCCTTGTGG + Intronic
1176952398 21:15064101-15064123 GAGCCCGGTGGAAGTCCGGGAGG - Intronic
1179032975 21:37736182-37736204 GAGCCCTGTGCTAGGCCCTGGGG + Intronic
1179508420 21:41856588-41856610 GAGCCCTCTGGAAGGCTATGAGG - Intronic
1179982402 21:44903216-44903238 CAGCCCTGTGGATGCCCTGGGGG + Intronic
1181542990 22:23583922-23583944 GAGACCTGGGGCTGTCCTTGGGG - Intergenic
1182086595 22:27565304-27565326 TAGCCCTGGGGAAAGCCTTGGGG + Intergenic
1184688063 22:46105254-46105276 GAGCCCTGTGGGAGCCCTGTGGG + Intronic
950419879 3:12892546-12892568 GGTCCCTGTGGAGGTCCTGGGGG - Intergenic
950847833 3:16031883-16031905 GAGCACTGTGGCAGTCATGGAGG + Intergenic
950897860 3:16469683-16469705 GTCCTCTGTGGAAGTCCTGGAGG - Intronic
950940564 3:16886020-16886042 GAGTACTGTGGAAGTTCTTTTGG + Intronic
953801186 3:46023832-46023854 GAGACGTGTGGAATTCCTTGTGG + Intronic
953814048 3:46139460-46139482 GAGCCCTGTGGTGGCTCTTGTGG - Intergenic
954636471 3:52073604-52073626 GAGCCCTCTGACAGTCCATGGGG + Intergenic
959187033 3:103057443-103057465 AAGCCCTGTGCAAGTGCTAGAGG - Intergenic
962261831 3:133915325-133915347 GTGCCCTCTGGAAGCCCTCGGGG + Intergenic
962875453 3:139532695-139532717 AAGCTCTGTGGGAGACCTTGGGG + Intronic
964476744 3:157104366-157104388 CAGCCCAGTGGAATTCCGTGGGG + Intergenic
966706835 3:182925491-182925513 CAGCCTTGTGAAAGACCTTGAGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969894720 4:10292787-10292809 GAGCCCTCTGAAAGTTCGTGAGG + Intergenic
973737341 4:53885642-53885664 GAGCCCTGTGGACTTCTCTGAGG - Intronic
974702419 4:65468930-65468952 GGGCCCTGTGGAGTTCCATGGGG + Intronic
974778863 4:66525197-66525219 GAGCCATTTGGAAGTTATTGAGG + Intergenic
975398787 4:73909828-73909850 AACCACTGTGGAAGTCCGTGTGG + Intergenic
976066009 4:81188442-81188464 AACCCCTGTGGAAGTCAGTGTGG + Intronic
977874367 4:102131179-102131201 TAGCACTGTGGAAGTAATTGGGG - Intergenic
978781968 4:112565915-112565937 CAACCCTGTGGAAGTCAGTGTGG + Intronic
981341450 4:143626419-143626441 GAACCCTTTGGAAATCCTTCTGG - Intronic
983252894 4:165364974-165364996 GAGCCCTGAGGAAATCCAGGAGG + Intronic
983502192 4:168512167-168512189 GAGCCCTATGGAAGACCAAGGGG + Exonic
988555922 5:32235949-32235971 GAGCCCTGTGTGAGACCCTGGGG - Intronic
989973145 5:50548540-50548562 GAGACCTGTGGAAGACTGTGTGG - Intergenic
991636546 5:68711417-68711439 GTGCCCTGGGGAAGTCCAAGAGG + Intergenic
993923156 5:93832135-93832157 GAGCCTTGCAGCAGTCCTTGTGG + Intronic
996884276 5:128337725-128337747 GAGCCCTGTGGAAGTCCTTGTGG - Intronic
997344825 5:133181284-133181306 AACCACTGTGGAAGTCCGTGTGG - Intergenic
997505167 5:134411547-134411569 GAGCCCTGGGAGAGGCCTTGAGG + Intronic
998426351 5:142032017-142032039 GATCCCTGTGGATCTCCGTGGGG + Intergenic
999263717 5:150253218-150253240 GAGCCCTGTGGAAGGCCGTAGGG + Intronic
1000095379 5:157966875-157966897 GACCCCTGGGCAAGTCCTTCAGG + Intergenic
1002004732 5:176222699-176222721 CATCCCTGTGCAAGTCCATGTGG - Intergenic
1002221645 5:177687921-177687943 CATCCCTGTGCAAGTCCATGTGG + Intergenic
1003220160 6:4154094-4154116 TAGGCCTCTGGAAATCCTTGAGG + Intergenic
1006143064 6:31942662-31942684 GAGCCATGTGGAAGTCTGGGGGG + Intronic
1008500928 6:52182225-52182247 GAGCCATCTGGAAGGCCTTGGGG - Intergenic
1013119128 6:107125907-107125929 GAGGCCCCTGGAAGTCCCTGGGG - Intergenic
1013561540 6:111309972-111309994 GCGCCCAGTGGAAGTCCTGCAGG - Exonic
1015007428 6:128300291-128300313 AACCCCTGTGGAAGTCAGTGGGG + Intronic
1017408889 6:154148645-154148667 GAGCCTTGTGGAGGTACCTGTGG - Intronic
1018381263 6:163260155-163260177 GAGCTCCATGGAAGTGCTTGGGG - Intronic
1019944864 7:4319399-4319421 GAGCCATGTGGGACTCCTTTTGG - Intergenic
1022795679 7:33729805-33729827 GAGCTTTCTGGAAGTCCTTGGGG + Intergenic
1024290857 7:47802684-47802706 GAGCCCTGATGAAGTTCCTGGGG - Intronic
1027277584 7:76575649-76575671 GAGCCATTTGAATGTCCTTGAGG + Intergenic
1027335985 7:77151212-77151234 GAGACCTGTGGAAGGCCATGTGG - Intronic
1029561028 7:101303061-101303083 GGGGGCTGTGGAAGTCCGTGGGG - Intergenic
1029561905 7:101308580-101308602 GGGGGCTGTGGAAGTCCCTGGGG - Intergenic
1029779803 7:102719884-102719906 GGGACCTGTGGAAGGCCATGTGG + Intergenic
1031246773 7:119323218-119323240 AACCCTTGTGGAAGTCATTGTGG - Intergenic
1034881675 7:154767563-154767585 GAGGCCTGTGGAGGTCAGTGAGG - Intronic
1034904234 7:154929806-154929828 GGGCCCTGTGGAACTTCGTGGGG - Intronic
1035311769 7:157974309-157974331 GAGCCCCGTGGAAGACCTTGTGG - Intronic
1035334148 7:158114768-158114790 CAGCCCTGTGGTAGTTCTTGGGG - Intronic
1035673182 8:1435667-1435689 GAGCCCTGGGCCAGTCCTTCAGG + Intergenic
1036438949 8:8762974-8762996 CAACCCTGTGGAAGTCAGTGTGG + Intergenic
1036663756 8:10725929-10725951 GAGCCAGGTGGAACTCCTGGGGG - Exonic
1037743837 8:21628018-21628040 GAGTCCTCTGCAAGTCCTGGTGG - Intergenic
1039835765 8:41255180-41255202 GAGCCTTGAGGAAGTCCAGGTGG + Intergenic
1044207669 8:89510176-89510198 AACCCCTGTGGAAGTCAGTGTGG - Intergenic
1044209383 8:89532797-89532819 AACCCCTGTGGAAGTCAGTGTGG - Intergenic
1045962443 8:107983652-107983674 GAGGCATGTGGAATTCCTTGTGG + Intronic
1046091795 8:109511766-109511788 AACCCCTGTGGAAGTCAGTGTGG - Intronic
1047165248 8:122431418-122431440 AGGGCCTGTGGAAGTCCTTATGG - Intergenic
1049227856 8:141466295-141466317 CAGCCCTATAGAAGTCCCTGTGG + Intergenic
1050328869 9:4524934-4524956 GGGCCCAGTGGGAGCCCTTGGGG - Intronic
1051597205 9:18836998-18837020 GAGCCTTTTGGAAGTCTTTAGGG + Intronic
1055587606 9:77771715-77771737 GGGCCCTGTGGAACTGCATGAGG + Intronic
1059355066 9:113692336-113692358 GAGCTGTGTGGAGGCCCTTGGGG + Intergenic
1061964770 9:134006966-134006988 GAGCCCAGTGAAAGTCTCTGGGG - Intergenic
1062379572 9:136280773-136280795 GAGGCCTGAGGAAGGCCTGGGGG - Intergenic
1187046927 X:15656029-15656051 CAGCCCTGTTCAAGTCCTAGGGG + Intronic
1187132098 X:16512823-16512845 GAGGCCTGTGGAGTTTCTTGAGG - Intergenic
1187307052 X:18104922-18104944 GAGCAGTGTGGAAGTCAGTGTGG + Intergenic
1189327142 X:40119687-40119709 GAGCACAGTGGGACTCCTTGGGG + Intronic
1189437429 X:41005540-41005562 GAGACCTCTTGAAGACCTTGGGG - Intergenic
1189746271 X:44171939-44171961 GAGCCATGTGGTAGTTATTGTGG - Intronic
1191050800 X:56189439-56189461 AACCCTTGTGGAAGTCATTGTGG + Intergenic
1192715880 X:73642090-73642112 GATCCTTGTGGAAGTCAGTGTGG - Intronic
1192782987 X:74312991-74313013 GGGACCTGTAGAAGTCCTTCAGG + Intergenic
1193543869 X:82803360-82803382 CAACCCTGTGGAAGTCAGTGTGG - Intergenic
1194630322 X:96274929-96274951 GACCCTTGTGGAAGTCAGTGTGG + Intergenic
1196482402 X:116164764-116164786 AAGCCTTGTGGAAGTCAGTGTGG + Intergenic
1199491552 X:148405677-148405699 TAGCCCTGGGAAACTCCTTGGGG - Intergenic
1202104714 Y:21351041-21351063 AACCACTGTGGAAGTCCATGTGG - Intergenic
1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG + Intergenic
1202501805 Y:25485326-25485348 GACCCCTCTGGAGGTACTTGAGG - Intergenic