ID: 996893375

View in Genome Browser
Species Human (GRCh38)
Location 5:128450209-128450231
Sequence TGTGCTCTGCTTAAGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 11, 3: 12, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996893375_996893380 30 Left 996893375 5:128450209-128450231 CCACCTCACTTAAGCAGAGCACA 0: 1
1: 0
2: 11
3: 12
4: 144
Right 996893380 5:128450262-128450284 CCAAGAAAGACTATATTCTGAGG 0: 1
1: 0
2: 2
3: 43
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996893375 Original CRISPR TGTGCTCTGCTTAAGTGAGG TGG (reversed) Intronic
901740422 1:11338321-11338343 TGTGCACTGCGTAAGGGAGAAGG - Intergenic
902123009 1:14183893-14183915 TGTGCTCTGCTGACCTAAGGAGG + Intergenic
902678216 1:18023809-18023831 TGTACACTGCTTAAGTGATGGGG + Intergenic
904562969 1:31411102-31411124 TGTGCTCTGGGTAGGAGAGGGGG + Intronic
907667715 1:56447946-56447968 CCTGCTCTGCTTGAGAGAGGTGG - Intergenic
907799777 1:57753086-57753108 TGTGTTCTGCCTGAGTCAGGAGG + Intronic
908741015 1:67327687-67327709 TGTGCTATTCCTGAGTGAGGAGG + Intronic
910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG + Intergenic
911535193 1:99091063-99091085 TGTGCTCTACTTGAGGGTGGAGG - Intergenic
922764888 1:228151581-228151603 TGTGCACTGCTTGTGTGTGGGGG + Intronic
922871060 1:228902351-228902373 TGTCCTGTGCAAAAGTGAGGAGG - Intergenic
924155978 1:241177035-241177057 TGTGCTCTGCTTGATTGACTTGG + Intronic
924251136 1:242134156-242134178 TATCCTCTGCCTAAGTGGGGTGG - Intronic
1065232785 10:23615611-23615633 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1067024112 10:42828486-42828508 TGTGCTCTGCTTCAGTGTGGAGG + Intronic
1075967997 10:126629434-126629456 TGTGCTGTGCATCAGGGAGGAGG - Intronic
1076862952 10:133150593-133150615 TGTGGTCTCCTTGAGTGGGGAGG + Intergenic
1083032701 11:59608275-59608297 CATGCTCTGCTTAAGTGATCAGG - Intronic
1085044317 11:73344369-73344391 TGTGCTCTGCCGCAGGGAGGAGG + Intronic
1086892630 11:92275635-92275657 TGTGGTCTTCTGAAGTGAAGAGG - Intergenic
1087206503 11:95401481-95401503 TGTACTCTGCTCAGGTGATGTGG - Intergenic
1089852583 11:121513273-121513295 TCAGCTCTGCTTCAGTGAAGTGG - Intronic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1095906624 12:47384972-47384994 GCTGCCCTGCTTGAGTGAGGTGG + Intergenic
1096630196 12:52921542-52921564 TGTGCACTGCATAAGTGAAGAGG - Intronic
1101237734 12:102806352-102806374 TGTGCTCTGGCTATGTGAGAGGG - Intergenic
1102177321 12:110885731-110885753 TGTCCTCTGCTTACATGATGAGG + Intronic
1105336651 13:19477197-19477219 TGGGGTCTACTTAAGTGGGGAGG + Intronic
1105510736 13:21049731-21049753 TTTGCTCTGCTCATGTGATGGGG - Intronic
1108601048 13:51995575-51995597 GGTGAACTGCTTTAGTGAGGAGG - Intronic
1111211219 13:85082766-85082788 TGTGATCTGTTTAAGTGAATGGG - Intergenic
1114750881 14:25203718-25203740 TGTACACTGCTTAGGTGATGGGG - Intergenic
1117063155 14:51983218-51983240 TGTACTGTTGTTAAGTGAGGAGG - Intergenic
1117439946 14:55750045-55750067 TGTGCTCTGCTTGACTTACGGGG - Intergenic
1121385008 14:93512347-93512369 TATGTTCTGCTTGAGTGTGGTGG + Intronic
1122209397 14:100165355-100165377 TGGGGTCTGCTGAAGTCAGGGGG - Intergenic
1123425262 15:20165526-20165548 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1123534486 15:21172060-21172082 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1124156340 15:27228218-27228240 TGGGGTCTGCTTAAGGCAGGAGG - Intronic
1124373554 15:29116676-29116698 TGCACTCTGCTTCACTGAGGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127363207 15:58263010-58263032 TGTGATCTGGAAAAGTGAGGGGG - Intronic
1127954269 15:63839233-63839255 TGTGCTCTGTTTAAAGGATGAGG - Intergenic
1128239411 15:66091351-66091373 TGAGCTCTGCTTAAAAGATGTGG - Intronic
1128789130 15:70419882-70419904 TGTGCTCAGAGTAAGTGATGTGG + Intergenic
1129173589 15:73823109-73823131 TGTGCTCTGCGTCAGGAAGGAGG - Intergenic
1129707930 15:77805258-77805280 TGTACTCTGTTTTAGAGAGGAGG - Intronic
1130257254 15:82331509-82331531 AGCTCTCTGCTGAAGTGAGGTGG + Intergenic
1130597697 15:85258480-85258502 AGCTCTCTGCTGAAGTGAGGTGG - Intergenic
1131249401 15:90820549-90820571 TCTGCTCTTCCTAGGTGAGGAGG - Intergenic
1133168032 16:3962597-3962619 TGAGCACTGCTTCAGAGAGGAGG - Intronic
1133894714 16:9915369-9915391 TGTGCTGTTCTTAAGGAAGGTGG - Intronic
1136859596 16:33690217-33690239 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1139222413 16:65197085-65197107 TGTGCTTTGCTTTAATGAGTAGG - Intergenic
1139564131 16:67762762-67762784 TGTGCTTTGCCTAAGTGTGTTGG - Intronic
1140617114 16:76678854-76678876 TGTGCTCTCCATATGTGGGGGGG + Intergenic
1203121102 16_KI270728v1_random:1538396-1538418 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1146738319 17:35258832-35258854 TGTGCTCTGCTGAATTCTGGTGG + Exonic
1146755047 17:35422862-35422884 TGTGCTCTGCTCAATTCTGGAGG - Exonic
1146761120 17:35479989-35480011 TGTGCTCTGCTGAATTCTGGAGG - Exonic
1148697635 17:49570661-49570683 TGTGCTCTGGTGGAGTGGGGAGG - Intergenic
1149090548 17:52772978-52773000 TGTGTTCTTCTTAACTGAGTTGG + Intergenic
1150616338 17:66775314-66775336 TGTGCTCGGCTGAAAGGAGGAGG - Intronic
1151410003 17:73917854-73917876 TGTTCTCATCTTAAGTTAGGAGG - Intergenic
1151659896 17:75513609-75513631 TGTGATCTGCATATTTGAGGAGG - Intronic
1153741029 18:8127823-8127845 TGAGCTCTACATAAGAGAGGAGG + Intronic
1157622001 18:49021984-49022006 TGTGCACTGCTTAACTGCAGAGG + Intergenic
1159949658 18:74473709-74473731 TGGGCTTTGCTTAAGGGAGATGG - Intergenic
1161627408 19:5335374-5335396 TTTGCACAGCTCAAGTGAGGAGG + Intronic
1163263590 19:16205496-16205518 TGTGCTGTGCTGGGGTGAGGCGG + Intronic
1167905859 19:52660156-52660178 TAAGCTTTGCTTAAGTGAGTGGG + Intronic
1168470222 19:56633928-56633950 TGTGTTTTCTTTAAGTGAGGGGG + Intergenic
927491571 2:23524551-23524573 TCTGCTCTGCCCAAGTGAGGAGG + Intronic
929103894 2:38344750-38344772 TGTGCTTTGCTTTAATGAGGAGG - Intronic
934457958 2:94191327-94191349 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
939875158 2:147569361-147569383 AGTGATCAGCTTCAGTGAGGAGG + Intergenic
941517802 2:166501422-166501444 TATACTCTGCTTCAGTGAGATGG - Intergenic
942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG + Intergenic
943079448 2:183240653-183240675 TGTGAACTCCTTAAGTCAGGTGG + Intergenic
946058211 2:216919466-216919488 TGTGCTCCCCTTCAGTGGGGTGG + Intergenic
946058221 2:216919507-216919529 TGTGCTCCCCTTCAGTGGGGCGG + Intergenic
948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG + Intronic
1169632629 20:7649972-7649994 TTTACTCTGCATATGTGAGGTGG + Intergenic
1170143243 20:13146263-13146285 TGGGATCTGCTTGAGGGAGGAGG + Intronic
1170614396 20:17937277-17937299 TCTGCCCTGCTGAAGTTAGGAGG - Intergenic
1171546118 20:26002907-26002929 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1175681930 20:60995388-60995410 TGTTCTCTGCATGAGTCAGGAGG + Intergenic
1175936995 20:62518492-62518514 TGTCCTCTGCCTCTGTGAGGGGG + Intergenic
1176736902 21:10557910-10557932 TGGGGTCTACTTAAGTGGGGAGG - Intronic
1179841684 21:44080051-44080073 TGCGCTCCTCTTCAGTGAGGTGG - Exonic
1180562903 22:16635450-16635472 TGGGGTCTACTTAAGTGGGGAGG - Intergenic
1180902857 22:19387111-19387133 TGTGCTCTGCTGGGGTGATGGGG - Intronic
1181084469 22:20433080-20433102 TGTGCTCTCCTGAAGTGCTGCGG - Intronic
951549140 3:23859379-23859401 TGTGCTCAGGTGAAGTGAGGAGG - Intronic
952810828 3:37401119-37401141 TGTGCACTGATTAATGGAGGTGG + Intronic
953822538 3:46220901-46220923 TGTACACTGCTTAGGTGATGGGG + Intronic
954816927 3:53289849-53289871 TGTGCTCTTTGTAAATGAGGAGG - Intronic
954966834 3:54619309-54619331 TGTGCACTGCTTAGGTGGAGGGG + Intronic
955230668 3:57096497-57096519 TCTTCTCTCCTTAGGTGAGGAGG - Exonic
959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG + Intronic
963979779 3:151524615-151524637 TGTGGTCTACTTGAGTGTGGAGG + Intergenic
965665611 3:171090512-171090534 AGTGTTCTGGTTCAGTGAGGAGG + Intronic
966616504 3:181919128-181919150 TGTGCTCTGCTTTACAGATGAGG - Intergenic
971261766 4:25063715-25063737 TGTGCTCTGCTAAAATTTGGTGG - Intergenic
976246917 4:83013277-83013299 TTTGATGTGCTTGAGTGAGGAGG + Intergenic
978373231 4:108050274-108050296 TGTACTCAGCTTAAGAGAGGAGG + Intronic
978373349 4:108050983-108051005 TGTACTCAGCTTAAGAGAGGAGG - Intronic
978628434 4:110714678-110714700 TGTGGACTACTAAAGTGAGGAGG + Intergenic
982538056 4:156631066-156631088 TGTGTTCTGTTGAAGAGAGGTGG - Intergenic
983518338 4:168679587-168679609 TGTGCACTCCATAAGTAAGGGGG - Intronic
986154836 5:5164354-5164376 TGTGTTCTGCATAAGTCAAGGGG + Intronic
987880437 5:23737274-23737296 TGGGATCTGCTTGAGTGGGGAGG - Intergenic
990991328 5:61686909-61686931 TTTGTTCTGCCTAATTGAGGAGG - Exonic
993607633 5:90013793-90013815 TGTGCTCACCTTAAGTGAAGTGG - Intergenic
994618870 5:102138808-102138830 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
995604297 5:113834699-113834721 TGTGCTCTGATTCCGTGGGGAGG + Intergenic
996671056 5:126118014-126118036 TTTGCTCTGCATATGTTAGGGGG - Intergenic
996893375 5:128450209-128450231 TGTGCTCTGCTTAAGTGAGGTGG - Intronic
996944530 5:129050598-129050620 TGTGCAGTTCTTAAGGGAGGCGG + Intergenic
998522262 5:142811945-142811967 AGTGCTATGATTAGGTGAGGAGG - Intronic
999512249 5:152264484-152264506 TGTGTTCTGCTGAAATGAGGGGG - Intergenic
1000106092 5:158060367-158060389 TGTGCTTAGCTTATGTAAGGGGG + Intergenic
1002984234 6:2172765-2172787 TGTGCTCTTCTAATGTGAGTAGG - Intronic
1003309394 6:4956280-4956302 TGTGCCCTGCGTGGGTGAGGAGG + Intergenic
1005843034 6:29756838-29756860 TGTGCACTGCTGAAGGGAGAGGG - Intergenic
1006663089 6:35665711-35665733 TGTGATCTGTTGAAGTTAGGTGG - Intronic
1009388209 6:63112129-63112151 TCTACTCTGCTACAGTGAGGTGG - Intergenic
1011219133 6:85035613-85035635 TGTGCCCTGCTCAATTCAGGTGG + Intergenic
1012309996 6:97711276-97711298 TGTGCTCAGATTAAATGTGGAGG + Intergenic
1014270796 6:119333496-119333518 TGTGTTCTGCTGGAGAGAGGCGG - Intronic
1014616750 6:123611365-123611387 TGTAGTCTGCTTAAGTTAGAGGG + Intronic
1015376305 6:132513872-132513894 TGTTGTCTGCTTAAGAGAGATGG + Intergenic
1017216497 6:151913310-151913332 TGTGTTCTGTTTACGTGTGGGGG - Intronic
1017687552 6:156928420-156928442 GGTGCTCTCCTTCGGTGAGGTGG + Intronic
1019571741 7:1716058-1716080 TGTGCTCTTCCTCAGTGAGTTGG + Intronic
1020486366 7:8725724-8725746 TTTGCTCTGCTTCAGAGAGTTGG + Intronic
1020715286 7:11667147-11667169 TGTACACTGCTCAGGTGAGGGGG - Intronic
1021942218 7:25689109-25689131 TGTACTCTGCTTCAGGGAGATGG - Intergenic
1022388427 7:29923299-29923321 TGCGCTGTGCTTATGTGTGGTGG - Intronic
1027683308 7:81247718-81247740 TGTGGTCTACTTGAGGGAGGAGG + Intergenic
1029619441 7:101680647-101680669 TGGGCTGTGCCCAAGTGAGGGGG - Intergenic
1030072262 7:105708106-105708128 CGTGCTCTGCTGAAGTGAGAAGG + Intronic
1030523030 7:110621605-110621627 GGTGCTATGTATAAGTGAGGAGG - Intergenic
1031006094 7:116473979-116474001 TGTACACTGCTTGAGTGAGGGGG + Intronic
1031386525 7:121158431-121158453 TGTGCTCTGGTTATGAAAGGGGG - Intronic
1031902083 7:127422098-127422120 TGGGTTCTACTTGAGTGAGGAGG - Intronic
1032463969 7:132131956-132131978 TGGACTCTCCTTAAGTGATGAGG + Intronic
1033818971 7:145110258-145110280 TGGGGTCTGCTTGAGGGAGGAGG - Intergenic
1039704141 8:39989881-39989903 TGGGCTCTGCTTAGGGGAAGAGG + Intronic
1041749707 8:61246961-61246983 TGGGGTCTGCTTGAGTGGGGAGG - Intronic
1043667113 8:82828067-82828089 TTTTTTCTGCTTAAGTGAGTAGG - Intergenic
1046164274 8:110409516-110409538 TGGGCTCTACTTAAGGGTGGAGG + Intergenic
1046573626 8:115997796-115997818 TGGGTTCTACTTAAGTGGGGAGG - Intergenic
1053688466 9:40567132-40567154 TGTGTTCTGCTTCAGTGTGGAGG - Intergenic
1054275564 9:63063926-63063948 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1054299707 9:63368043-63368065 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054399269 9:64701005-64701027 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054432848 9:65185270-65185292 TGTGCTCTGCTTCAGTGTGGAGG - Intergenic
1054497537 9:65836405-65836427 TGTGCTCTGCTTCAGTGTGGAGG + Intergenic
1057469666 9:95346214-95346236 TGAGCCCTGCTTCAGTGAGCTGG - Intergenic
1060491914 9:124091403-124091425 TGTGCAGTGCTCAAGTGGGGAGG + Intergenic
1061479742 9:130891594-130891616 TCTGCTTGGCTTAAGGGAGGGGG - Intergenic
1061949211 9:133926828-133926850 TGTGCTCTGCTTAGCTCAGCTGG - Intronic
1186214059 X:7280389-7280411 TGTGCCCTGCTGAAATGATGTGG - Intronic
1186367890 X:8914338-8914360 TGTCCACTGCATAAGTTAGGAGG + Intergenic
1188450150 X:30300737-30300759 TTGGCTCTGCTGAAGTAAGGGGG + Intergenic
1189098083 X:38160882-38160904 TTTGCTCTTCTAAAGAGAGGGGG + Intronic
1192268309 X:69555657-69555679 TGGTTTCTGCTTCAGTGAGGGGG + Intergenic