ID: 996893579

View in Genome Browser
Species Human (GRCh38)
Location 5:128453675-128453697
Sequence GAGATGAATAATAAAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 769}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996893579_996893582 13 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893582 5:128453711-128453733 TTCCTGCTGAAATGCAGAGTGGG 0: 1
1: 0
2: 1
3: 27
4: 218
996893579_996893586 26 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893586 5:128453724-128453746 GCAGAGTGGGGAAGGCTCAAAGG No data
996893579_996893583 14 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893583 5:128453712-128453734 TCCTGCTGAAATGCAGAGTGGGG 0: 1
1: 0
2: 3
3: 32
4: 270
996893579_996893581 12 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893581 5:128453710-128453732 TTTCCTGCTGAAATGCAGAGTGG 0: 1
1: 0
2: 0
3: 26
4: 283
996893579_996893585 18 Left 996893579 5:128453675-128453697 CCTTTCTCTTTATTATTCATCTC 0: 1
1: 0
2: 7
3: 91
4: 769
Right 996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996893579 Original CRISPR GAGATGAATAATAAAGAGAA AGG (reversed) Intronic
900875293 1:5338258-5338280 GAGAGGAAAAAGAGAGAGAAGGG - Intergenic
901735353 1:11308881-11308903 GAGATGATTGATAATGAGTAGGG + Intergenic
902242818 1:15100159-15100181 GAGATGGGTAATACAGAGACAGG + Intronic
902373711 1:16020300-16020322 GAGATGAATAAGGCAGAGACAGG + Intronic
904444840 1:30562091-30562113 GAGATTAATAAGAAATGGAATGG + Intergenic
906081443 1:43091577-43091599 GAGATTAATAAGAAACAGAATGG - Intergenic
907139189 1:52169435-52169457 AAGATGAAAAATAAAGAGAGAGG - Intronic
907908973 1:58810597-58810619 GGAATGAATAACAAAGAGAAAGG + Intergenic
908028160 1:59972462-59972484 TGGATGAATAATACAGGGAAAGG + Intergenic
908049401 1:60211263-60211285 GAAAAGGAGAATAAAGAGAATGG - Intergenic
908471124 1:64444914-64444936 TAGATGAATTTTAAGGAGAATGG + Intergenic
908848935 1:68354148-68354170 GACTTGAATAAGAATGAGAATGG - Intergenic
909106567 1:71417363-71417385 GAGCTGAAGAAAAAAGAGATAGG + Intronic
909350185 1:74643452-74643474 AATATGAACTATAAAGAGAATGG + Intronic
909369638 1:74869255-74869277 GAGAGGAATAATACAGAAAATGG + Intergenic
909381910 1:75008450-75008472 GAGATGAATAGTAACTACAATGG - Intergenic
909528146 1:76650327-76650349 GAGATGAAGAAAGTAGAGAAAGG + Intergenic
909732742 1:78915042-78915064 GATATGTACAATGAAGAGAATGG - Intronic
909842056 1:80339296-80339318 GAGAGGAATAATTAAGATAGTGG - Intergenic
909843515 1:80360468-80360490 CTGATTAATAATCAAGAGAAAGG - Intergenic
909897327 1:81089055-81089077 GAGATGAATCATGAAGAGGAGGG - Intergenic
910199717 1:84686725-84686747 GAGAAGACTTTTAAAGAGAAAGG + Intronic
910510438 1:87997847-87997869 GAGATGAATATAATATAGAAAGG + Intergenic
910644454 1:89498486-89498508 GAGCTGAAGAATACAGAAAATGG - Intergenic
911088583 1:93999992-94000014 CAGATAAATAATTGAGAGAAAGG - Intronic
911133091 1:94410748-94410770 CAGATGATTAATAAATGGAACGG + Intergenic
911955231 1:104225117-104225139 GATCAAAATAATAAAGAGAAAGG - Intergenic
912562359 1:110560046-110560068 GAGATGAGTACTAAAAAGCAAGG + Intergenic
912844324 1:113065779-113065801 TAGATGGAGAATAAAGGGAAAGG + Intergenic
913202817 1:116509669-116509691 GAGAAGAATAAAACAGGGAAGGG - Intergenic
913367704 1:118060169-118060191 CACATGAAAGATAAAGAGAAAGG - Intronic
913440509 1:118892008-118892030 GAGAGAAATAAAAATGAGAATGG + Intronic
913718025 1:121558297-121558319 GGGAAGAAAAAGAAAGAGAAAGG - Intergenic
915172076 1:153985376-153985398 GAGATGAAGAAAGAAGAGAAGGG + Intronic
915436954 1:155914284-155914306 AAGATGAAAACTACAGAGAAGGG - Exonic
915830790 1:159127869-159127891 GAGATGAATACTCCAGGGAAAGG - Intronic
916008432 1:160682514-160682536 GAGAGGAAAAAGAAAAAGAAGGG + Intronic
916837694 1:168565060-168565082 CACACAAATAATAAAGAGAAGGG + Intergenic
916925257 1:169512675-169512697 GACATGAATCATGAAAAGAAAGG + Intergenic
917130822 1:171741281-171741303 AAGACGAATCAGAAAGAGAATGG - Intronic
917567427 1:176227111-176227133 GAGAATAACAATAAAGAGATAGG + Intergenic
917663390 1:177199801-177199823 GAGAAGAATAAGGAAAAGAAAGG - Intronic
918747075 1:188216701-188216723 GAGATGAAAAATACAGTGCATGG + Intergenic
919233204 1:194802873-194802895 AATATGAAGAAGAAAGAGAAAGG + Intergenic
919351011 1:196453994-196454016 GGGAAGAATAATAAAAAAAATGG - Intronic
919366051 1:196662463-196662485 GAAATGAAAAACAAAGAAAATGG - Intronic
919443878 1:197676658-197676680 AATAGGAATAATAAAAAGAATGG + Intronic
919718378 1:200804692-200804714 CAGATGAATGACTAAGAGAAAGG + Intronic
921308831 1:213823045-213823067 GAGATGAATATTAGAGACACGGG - Intergenic
921504353 1:215949470-215949492 GAAATGAATAATAACCTGAAGGG + Intronic
921670351 1:217917818-217917840 GAGAAAAATAATAAAAATAAAGG + Intergenic
921672486 1:217941743-217941765 GAGAAGAGGAATAGAGAGAAGGG + Intergenic
922403603 1:225287399-225287421 GAGTTGAATAATGAAGTAAATGG + Intronic
923042759 1:230331580-230331602 GAGATGAAGAAGGAAAAGAAAGG - Intronic
923726827 1:236513169-236513191 GTTATGAATAATTAAGATAAGGG - Intergenic
923847493 1:237751815-237751837 AAGATCAGTAATAAAGAGAGTGG + Intronic
923924759 1:238612459-238612481 CAGATGAATGATAAATTGAATGG + Intergenic
923931352 1:238701334-238701356 GAAATTTATAATAAAGAGAAAGG - Intergenic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924149439 1:241113236-241113258 GAAATGAATAAAAAATAAAAAGG + Intronic
924689087 1:246327889-246327911 GAGTTGAATAAACAAGATAAAGG + Intronic
924819230 1:247472325-247472347 AAGTTGAAAAATAAAAAGAAAGG - Intergenic
1063074824 10:2704431-2704453 GAGATGGATAGTAAATAGAATGG + Intergenic
1063491528 10:6468340-6468362 GAGAATGAGAATAAAGAGAATGG + Intronic
1063647115 10:7896227-7896249 GAGAAAAAGAATATAGAGAAGGG - Intronic
1063817941 10:9798512-9798534 TATATTAATAATAAAAAGAAGGG - Intergenic
1064742929 10:18451612-18451634 GAGAGGAGTAACAAAGAAAATGG - Intronic
1064884589 10:20096399-20096421 GGGATGAACAGAAAAGAGAAGGG + Intronic
1065011072 10:21421327-21421349 AAAATGAATAAGAAACAGAAAGG + Intergenic
1065365136 10:24928223-24928245 GAGAGGAAAAATAAAGAAATAGG - Intronic
1065809840 10:29431186-29431208 GAGAGACATAAGAAAGAGAAAGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1066706902 10:38190082-38190104 CAGATGAATAAAGAAGAAAAGGG + Intergenic
1067073041 10:43150986-43151008 GAGATGAAAAATACACTGAATGG - Intronic
1067131031 10:43565507-43565529 GAGAGTAATGATAAAGAAAAAGG + Intronic
1068004958 10:51382191-51382213 GTTATGAATAATATAGAAAAGGG + Intronic
1068090552 10:52427804-52427826 TAGATAAATTATGAAGAGAATGG + Intergenic
1068198765 10:53754626-53754648 GAAATGAAGAATAAACAAAATGG - Intergenic
1068299059 10:55114780-55114802 GAGATGGATAGTACAGAGCATGG - Intronic
1069074846 10:64028175-64028197 GAAATGAAAAATAAATAAAACGG + Intergenic
1069367573 10:67710377-67710399 GAGATTAATCCTGAAGAGAATGG + Intergenic
1069512492 10:69052835-69052857 GAAATGAATAAACAAGTGAATGG + Intergenic
1070077751 10:73154637-73154659 GAAATGGAAAATAAAGAAAAGGG + Intronic
1070205140 10:74251265-74251287 GAGATGCCTATTCAAGAGAAAGG + Intronic
1070285002 10:75076486-75076508 GAGATGACGAATGAAGAAAAAGG - Intergenic
1070572466 10:77650488-77650510 GAGAAGAAAAAGAAAGAGAAGGG + Intergenic
1070970133 10:80557846-80557868 GAAAGAAATAATAAAGATAATGG - Intronic
1071437000 10:85656689-85656711 GCGATACATAAGAAAGAGAAGGG - Intronic
1072223121 10:93344565-93344587 GAGAAAAATAAGAAAAAGAAGGG + Intronic
1072325132 10:94290313-94290335 GAGAAAAATAAGAAAGAAAATGG - Intronic
1073843204 10:107521975-107521997 TAGATAATTAAAAAAGAGAATGG + Intergenic
1073941158 10:108700003-108700025 AAGATGTATTATACAGAGAAAGG - Intergenic
1074195068 10:111176574-111176596 GAGAGGAAAATAAAAGAGAAAGG - Intergenic
1074292985 10:112154901-112154923 GAGGTAAATAAGAAAGGGAAGGG + Intronic
1074314458 10:112349036-112349058 GAGAGGAAAAGTGAAGAGAAAGG + Intergenic
1074514305 10:114150594-114150616 CAGATGAATAAAAAAGTGTATGG - Intronic
1074636266 10:115321482-115321504 GACACAAATAAGAAAGAGAAAGG - Intronic
1074738536 10:116461616-116461638 GAAATGAATACAAAAGACAAAGG + Intronic
1075280953 10:121137852-121137874 GCAAGGAATAATTAAGAGAAGGG + Intergenic
1075302032 10:121333457-121333479 GGGATAGATAAAAAAGAGAAAGG + Intergenic
1075500326 10:122967242-122967264 AAGATTAAAAAAAAAGAGAAGGG + Intronic
1077346210 11:2056846-2056868 GAGAAGAGAAAAAAAGAGAATGG - Intergenic
1077346417 11:2058693-2058715 GAGATGAAAAAAATGGAGAATGG - Intergenic
1077893144 11:6434052-6434074 GAGGACAATAAGAAAGAGAAAGG - Intronic
1078335861 11:10462695-10462717 GAGATGAATAAGGATGAGATGGG + Intronic
1078457811 11:11488970-11488992 GGAATGAAGAATAAAAAGAAGGG + Intronic
1079068195 11:17317218-17317240 GAGATTAAAAATAGAGAGGAGGG - Intronic
1079724893 11:23868500-23868522 GAGAGATATAATAAAGAGTATGG - Intergenic
1080007899 11:27429133-27429155 GAGGAGAAAAATAAAGAAAATGG + Intronic
1080064880 11:28000126-28000148 GAGATTAATGAGAAATAGAATGG + Intergenic
1080102713 11:28477768-28477790 AAGATGAATATTAAAAACAATGG - Intergenic
1080487534 11:32726455-32726477 GAGAGGATTATTAAAGTGAAAGG + Intronic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080623461 11:34007320-34007342 GGGAGGAAGAATAAAGAGAGGGG + Intergenic
1080906469 11:36550829-36550851 GATATGAACAATAGAGAGAAAGG - Intronic
1081018722 11:37915799-37915821 GAGATGCATAAGAAAGAAGACGG - Intergenic
1081398249 11:42612630-42612652 GAGATGACTATAAAAAAGAAGGG - Intergenic
1081418366 11:42842355-42842377 GAGGTGAAAAGTCAAGAGAAGGG - Intergenic
1081979262 11:47256335-47256357 GTGTTGAAAAATAAATAGAACGG - Intronic
1082291840 11:50384713-50384735 CAGCTGAGAAATAAAGAGAAAGG - Intergenic
1082725783 11:56734925-56734947 GAGATGAGTAAGAAACAGAATGG - Intergenic
1082907211 11:58321575-58321597 GAAATGAATGATAAGGAGAGTGG - Intergenic
1083134489 11:60659084-60659106 TTGAAGAATAATAAAGAGAGTGG + Intergenic
1085081790 11:73641067-73641089 GAGATAAAGAATAAAGAGGCTGG + Intergenic
1085336085 11:75697253-75697275 GAGAGGTATAAAAATGAGAAAGG - Intergenic
1085581938 11:77658980-77659002 TAAATGAATATCAAAGAGAAAGG - Intergenic
1085994019 11:81888869-81888891 GATATGGATAAGAAAGAGGACGG - Intergenic
1086119517 11:83291369-83291391 GAGAAGAATAATATTGTGAAGGG - Intergenic
1086169838 11:83823580-83823602 GAGATGAATAAAACTGAGAGGGG + Intronic
1086187116 11:84031745-84031767 GTGAAGTATACTAAAGAGAAGGG - Intronic
1086562328 11:88182094-88182116 GAGATGGGTAACAAAGAGAGAGG - Intergenic
1086645793 11:89218692-89218714 AAGAAGAATAATTAAGATAATGG - Intronic
1086890851 11:92256507-92256529 GAGATAAATAAAAAAGAGATAGG + Intergenic
1087826837 11:102774463-102774485 TTGATGAAGAAAAAAGAGAAAGG + Intronic
1087886066 11:103484291-103484313 GAGATGAAGATGAAAGAAAATGG - Intergenic
1087999654 11:104861605-104861627 GAGAAGAAAAATAAAGAAAAAGG + Intergenic
1088262458 11:107957101-107957123 GAAAGGAAGAATAGAGAGAAAGG + Intronic
1089021996 11:115225709-115225731 GAGAGGAAGGATAAAAAGAAAGG - Intronic
1089028487 11:115296693-115296715 GAGATAATTTATAAAGAAAAGGG - Intronic
1089274030 11:117321473-117321495 GAGAAAAATAAAATAGAGAAAGG + Intronic
1089993565 11:122883369-122883391 AAGATGAATCGTAAAGAAAAAGG - Intronic
1090181032 11:124699574-124699596 GAGATACATAACAAGGAGAAAGG - Intergenic
1090802944 11:130185291-130185313 GAGATGGATAATACAGAGAAAGG + Intronic
1091106824 11:132929112-132929134 GAGATAAACAAAATAGAGAATGG + Intronic
1092069580 12:5621816-5621838 AAGAGGAAGAAGAAAGAGAAGGG + Intronic
1092299403 12:7231176-7231198 GAGTTGTAAAATAAAGTGAATGG + Intergenic
1092851348 12:12630580-12630602 GAGATGAATAAAATAAAGAATGG - Intronic
1092949036 12:13483384-13483406 AAGAAGAATAATAATGACAATGG + Intergenic
1093206049 12:16251345-16251367 GAGATAAACAAAATAGAGAATGG + Intronic
1093225431 12:16478017-16478039 TAAATAAATAATACAGAGAAAGG - Intronic
1094283809 12:28769833-28769855 GAGATAAATAAGAAAAACAAAGG - Intergenic
1094438574 12:30449505-30449527 AAGATGCATAATAAAGAAATGGG - Intergenic
1094778298 12:33758249-33758271 GGGAAGAGAAATAAAGAGAAAGG + Intergenic
1095818670 12:46452765-46452787 TAAATGAATTATAAAGACAATGG + Intergenic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096948613 12:55439437-55439459 CAGATGAATGTTAAAGTGAATGG + Intergenic
1097244604 12:57600529-57600551 GACCTGAAGAATAAAGGGAAGGG - Intronic
1097315805 12:58170547-58170569 TAGATGAATAATAACAAGAAAGG - Intergenic
1097375134 12:58834305-58834327 GAAATAAATGATAAAGTGAAGGG + Intergenic
1097483928 12:60169254-60169276 GTGATGAAGAATAAAGTGAGAGG + Intergenic
1097761986 12:63476951-63476973 CAGATTAATAATAAAAAGATAGG - Intergenic
1097826396 12:64178806-64178828 GAGAAGAAAAAAAAAGGGAAGGG + Intergenic
1097918825 12:65049492-65049514 CAGATGAATAATAGAGTGATAGG - Intergenic
1098329561 12:69339093-69339115 GAGATTAAGAAAAAAGGGAAAGG - Intergenic
1098381431 12:69873858-69873880 CAGAAGAATAAGAAACAGAAGGG - Intronic
1099480812 12:83163915-83163937 GTTATAAATAATAAAGACAAAGG + Intergenic
1099755993 12:86849083-86849105 GGGATGAATACTAAAGTCAAAGG + Intergenic
1099865043 12:88269514-88269536 GAGATAAACCATAAGGAGAAAGG - Intergenic
1100731081 12:97470319-97470341 GAGAAGAATATTAAAAAGATAGG + Intergenic
1100946919 12:99795547-99795569 GTAATGATAAATAAAGAGAATGG + Intronic
1100983419 12:100182250-100182272 GAGCAGAGTAATAAAGAGAAGGG + Intergenic
1101063371 12:100994770-100994792 GAGATCAACAGTAAACAGAAAGG + Intronic
1101133575 12:101714923-101714945 GACCTGAATAATATAGAAAAGGG + Intronic
1101611560 12:106297238-106297260 AATATGAATAAAAAAGAGATGGG + Intronic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1102524633 12:113503349-113503371 TAGATGATTGATAGAGAGAATGG - Intergenic
1103201234 12:119089555-119089577 GAGAAGAATGATAATGACAAAGG + Intronic
1104559893 12:129834134-129834156 GAGATGAAGAAGGAAGGGAAAGG - Intronic
1105724612 13:23149112-23149134 GAGAAGAAAAAAATAGAGAAAGG + Intergenic
1105934352 13:25085531-25085553 GAGATTAATAAGAAGCAGAATGG + Intergenic
1106062269 13:26305538-26305560 GAGAGGGACAAGAAAGAGAAAGG - Intronic
1106359152 13:29014010-29014032 GAAATGAAAGACAAAGAGAAGGG - Intronic
1106362802 13:29048161-29048183 GAGATGAAAAATACACTGAAAGG - Intronic
1106392888 13:29352858-29352880 GAGATGAAAAATACACTGAAAGG - Intronic
1106886480 13:34190614-34190636 GAAATTAATACTAAAGGGAAAGG - Intergenic
1106954075 13:34916235-34916257 GAGATGAAGAATCAAGAACAGGG + Intergenic
1108264747 13:48695363-48695385 GAAAGAAAGAATAAAGAGAAAGG - Intronic
1108527049 13:51294220-51294242 GAGCTGGAGAATAAAAAGAATGG - Intergenic
1108875161 13:55038395-55038417 GAGATTTAGCATAAAGAGAAAGG + Intergenic
1109785662 13:67171600-67171622 GAAATGCATAATAAAGATAAAGG - Intronic
1109823587 13:67688744-67688766 GAGATGAAAAATACACTGAAGGG - Intergenic
1109826612 13:67729751-67729773 GAGAAGAAGAATAAAAAGAGAGG + Intergenic
1110578563 13:77090964-77090986 TAGAGAAATAAGAAAGAGAAGGG - Intronic
1111000233 13:82169205-82169227 GAGAAAAATAATAAAGACTAGGG + Intergenic
1111045463 13:82808306-82808328 AAGATGAATAAAGAAGAAAAAGG + Intergenic
1111350936 13:87030354-87030376 AATATTAATAATAAAGAAAAAGG + Intergenic
1111414126 13:87916716-87916738 AATATGAATAATAAAAATAATGG - Intergenic
1111466230 13:88614948-88614970 GACATTAATAATAAAGGGATGGG - Intergenic
1111584352 13:90264621-90264643 AAAATGAATCATACAGAGAAGGG - Intergenic
1111894424 13:94123479-94123501 GAGATGACTATTAAAGAACAAGG - Intronic
1112256921 13:97842449-97842471 GAGAGGCAGAAAAAAGAGAAAGG - Intergenic
1112535640 13:100252422-100252444 GAAAGGAAAAATAAAAAGAAGGG - Intronic
1113409711 13:110073879-110073901 GAGGAGTATAATAAAGAGATAGG - Intergenic
1114882164 14:26799288-26799310 GAGAAGAACAATAACGAAAAAGG + Intergenic
1114994644 14:28332673-28332695 AAGAAGAATAAGAAAGACAAAGG + Intergenic
1115031395 14:28799894-28799916 GAGTTGACTAATAAAAGGAATGG - Intronic
1115192827 14:30764672-30764694 GAGAATAAAAACAAAGAGAATGG + Intergenic
1115744889 14:36426388-36426410 TAGCTTAATAAAAAAGAGAAAGG - Intergenic
1115795706 14:36933089-36933111 GAGATGAATAACTAAAATAAGGG + Intronic
1116135394 14:40916798-40916820 GAGATAAATAAGAAAGTGATAGG - Intergenic
1116246747 14:42425101-42425123 GAGAAGAACTATAAAGAAAAGGG - Intergenic
1116251410 14:42487923-42487945 GTGGCGAATAATAAAGATAATGG - Intergenic
1116265944 14:42690232-42690254 AAGATGAAAAATAGAAAGAACGG + Intergenic
1116339712 14:43705717-43705739 TAGATGAATAACAAAGACAAAGG - Intergenic
1116343664 14:43759502-43759524 GAGAAGAAAAATGAAAAGAACGG - Intergenic
1116497893 14:45585043-45585065 AACATGAATAAGAAAAAGAAAGG - Intergenic
1116602497 14:46944612-46944634 GGATTGAAGAATAAAGAGAAGGG - Intronic
1116707812 14:48325402-48325424 GAAAAGAAAAAGAAAGAGAAAGG + Intergenic
1116980351 14:51163471-51163493 GAGATTAATAAGAAATGGAATGG - Intergenic
1117090927 14:52249269-52249291 GATATGAAACAAAAAGAGAAAGG - Intergenic
1117496125 14:56306749-56306771 GACATGAGTATTAACGAGAACGG - Intergenic
1118033464 14:61840587-61840609 TAAATGAATAATAAAGAAAAAGG - Intergenic
1118169402 14:63372083-63372105 GAGAGAAAAAAAAAAGAGAAAGG + Exonic
1118602157 14:67478376-67478398 GAGAAGAGTAATGAAGAGGAGGG - Intronic
1118678923 14:68219058-68219080 GAAAAGATTAATAAAGAGAAAGG + Intronic
1118792865 14:69111453-69111475 GACAAGGATAATAAAGAGAGTGG - Intronic
1119081306 14:71696926-71696948 AAGATGAATAATAGTGTGAATGG + Intronic
1119377026 14:74203263-74203285 GAGATGAAGAAAACAGAAAATGG - Intergenic
1119712702 14:76834395-76834417 CAAATGAATGATACAGAGAATGG - Intronic
1119792264 14:77362480-77362502 TAAACAAATAATAAAGAGAAAGG + Intronic
1119798140 14:77418050-77418072 GAGATAAATAACAAAAAGCAGGG - Intronic
1119952699 14:78762093-78762115 TAGTTTAATAATAAAGAGAATGG - Intronic
1119975988 14:79024278-79024300 GAGAAGAAAAAAAGAGAGAAAGG - Intronic
1120439219 14:84513984-84514006 AAAATAAATAATAAAAAGAATGG - Intergenic
1121132639 14:91462758-91462780 GATTTGAACAACAAAGAGAAAGG - Exonic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121421208 14:93816435-93816457 TTGAGGAATAAAAAAGAGAAAGG - Intergenic
1121497783 14:94408495-94408517 GAGATGAATAACAGATAAAATGG - Intergenic
1121606147 14:95241421-95241443 CACATGAAAAACAAAGAGAAAGG + Intronic
1123459027 15:20451446-20451468 AAAATAAAAAATAAAGAGAAAGG + Intergenic
1123659034 15:22548972-22548994 AAAATAAAAAATAAAGAGAAAGG - Intergenic
1124004023 15:25782068-25782090 CAGGTGAATAATAAACAAAATGG + Intronic
1124265266 15:28227285-28227307 AAAATAAACAATAAAGAGAAAGG + Intronic
1124312899 15:28643464-28643486 AAAATAAAAAATAAAGAGAAAGG - Intergenic
1125335076 15:38618906-38618928 TAGAAGGATAATAAAGAGAAGGG + Intergenic
1126193936 15:45910672-45910694 GAGATTAATAAGAAATGGAATGG - Intergenic
1126198936 15:45963565-45963587 GAGTTGAGTAAAAAGGAGAAGGG + Intergenic
1126307897 15:47281827-47281849 GAAATGAAAAATAATAAGAATGG - Intronic
1126367188 15:47906316-47906338 AAGATGAAGAAGAAAGATAAAGG + Intergenic
1126399052 15:48250572-48250594 GAAAAGAGTAAAAAAGAGAACGG + Intronic
1126490133 15:49227775-49227797 CTCATGAATAAGAAAGAGAAAGG - Intronic
1126785845 15:52177355-52177377 AAGATGAATAAAGAAAAGAATGG + Intronic
1127112961 15:55694134-55694156 GAGATAAATTAAAAAGAGATAGG + Intronic
1127391449 15:58508205-58508227 GAGATGAAGAATTGAGAGATGGG + Intronic
1127399583 15:58572822-58572844 GAGATAAACAACAGAGAGAATGG - Intergenic
1127706611 15:61553316-61553338 GATATGGATAGTAAAGAGAATGG + Intergenic
1127791647 15:62403768-62403790 GAGATTCCTAATGAAGAGAAAGG - Intronic
1128095608 15:64952231-64952253 GAGAAGAATAAGAAGAAGAAAGG - Intronic
1128461850 15:67875643-67875665 AATATGAATATAAAAGAGAATGG + Intergenic
1128601001 15:68995255-68995277 GAGAATAATAATAAAGAGAATGG - Intronic
1128778798 15:70344204-70344226 GAAAAGAATAAATAAGAGAAGGG - Intergenic
1129952128 15:79601226-79601248 AAGAGGAATAGTCAAGAGAAAGG + Intergenic
1130129495 15:81127124-81127146 GAGATTAATAAGAAACAGAATGG - Intronic
1130534467 15:84773715-84773737 GAGATGAAAATTTAGGAGAAAGG - Intronic
1130627480 15:85530436-85530458 GAGATCAATAAGAAAGGAAAAGG + Intronic
1130701032 15:86182038-86182060 GAAGTGAATAAAATAGAGAAGGG + Intronic
1130826684 15:87555179-87555201 TAGAGAAATAATAAAGACAAAGG - Intergenic
1132319102 15:100912080-100912102 GAGATCATCAATAAAAAGAACGG - Intronic
1132436969 15:101814690-101814712 GAGATGAGAAAAAAAGAAAAGGG - Intronic
1133651929 16:7820727-7820749 GAAATGGAAAAGAAAGAGAAAGG + Intergenic
1134480130 16:14612111-14612133 GAGATGAAGGATAAAGGGAAAGG + Intronic
1134593259 16:15474678-15474700 AATAAGAATAAAAAAGAGAAAGG - Intronic
1136357838 16:29757883-29757905 GTGATGAATAAGAAATGGAATGG - Intergenic
1136633535 16:31504198-31504220 GATATGAAAAAAAAAAAGAAAGG - Intronic
1136703453 16:32164725-32164747 AAAATAAAAAATAAAGAGAAAGG + Intergenic
1136764248 16:32762874-32762896 AAAATAAAAAATAAAGAGAAAGG - Intergenic
1136803850 16:33107512-33107534 AAAATAAAAAATAAAGAGAAAGG + Intergenic
1137063896 16:35816544-35816566 GAGATTAATAATAAACAGAATGG + Intergenic
1137333519 16:47525721-47525743 AAGATGAATAATGAAGAGTTGGG - Intronic
1137479993 16:48844373-48844395 TAGATGAATAAGAAAATGAATGG - Intergenic
1137973485 16:53009581-53009603 TACATGAAAGATAAAGAGAAAGG - Intergenic
1138065134 16:53932858-53932880 GAGAGGAATGATAAAGAAACGGG - Intronic
1138769312 16:59644422-59644444 GAAAAAAATAATAAAGATAAGGG - Intergenic
1139197202 16:64933371-64933393 GAAAGGCAAAATAAAGAGAAGGG - Intergenic
1203066603 16_KI270728v1_random:1024998-1025020 AAAATAAAAAATAAAGAGAAAGG - Intergenic
1142935037 17:3322224-3322246 TAGATGAATAAAAATGAAAAAGG - Intergenic
1142999785 17:3785821-3785843 AACATGAATAAAAAATAGAAAGG + Intronic
1143098755 17:4493158-4493180 GAGATGAATCAGAAAGGGTACGG + Intergenic
1143193237 17:5055859-5055881 GAAATGAAAAAGAAAGTGAAGGG - Intergenic
1144225977 17:13146899-13146921 GAGAATACTAATAAAGATAAAGG - Intergenic
1145820735 17:27832563-27832585 GAAATTAATAAGAAGGAGAATGG + Intronic
1146110074 17:30081425-30081447 AGGATGAAAAATAAAGAAAAAGG + Intronic
1146111777 17:30096235-30096257 GATAAGAAACATAAAGAGAATGG - Intronic
1146509673 17:33436001-33436023 GTGAAGAAAAATAAAGAGAAAGG + Intronic
1147014185 17:37477394-37477416 CAGATTTAAAATAAAGAGAAAGG + Exonic
1147050325 17:37789725-37789747 GAGAGAAATGATAAAGGGAAGGG - Intergenic
1147342680 17:39763571-39763593 GAGAGGAACAAAAAACAGAAAGG - Intergenic
1148512493 17:48184371-48184393 CAGTCGAAGAATAAAGAGAATGG + Intronic
1148707187 17:49645701-49645723 GAGATGATTAAAAGAGAGATTGG - Intronic
1149047792 17:52267681-52267703 GAGAAAAATAAAACAGAGAAAGG - Intergenic
1149422766 17:56527352-56527374 GAGATGAAAAATAAAGAATTTGG - Intergenic
1150053102 17:61984769-61984791 AATATGAATAATAAAGAATATGG - Exonic
1150886089 17:69087725-69087747 GACATGAATTTTAAAGAGAAAGG - Intronic
1151319456 17:73343742-73343764 GAGATGAACAAAAAAGCAAAAGG - Intronic
1151354866 17:73552347-73552369 CAAATGAATAATAAAAACAAAGG - Intronic
1151849208 17:76680246-76680268 TAGATGAAAAATAAGGGGAATGG + Intronic
1153538723 18:6132605-6132627 GAGAAGAATATAAAAAAGAAAGG - Intronic
1153592435 18:6687601-6687623 TGGATGTATAATAAAGGGAAGGG + Intergenic
1153639366 18:7143091-7143113 GAGATGAAAAATACAGTGAATGG - Intergenic
1153801334 18:8673179-8673201 GAGATTAATAATAAATGAAATGG - Intergenic
1154122853 18:11665549-11665571 GAGATGGAAAGTAAAGAGAATGG + Intergenic
1155104822 18:22653113-22653135 GTAATGAAGAAAAAAGAGAAGGG - Intergenic
1155546949 18:26925257-26925279 GAGAAGAATATTCAAGAGAGAGG - Intronic
1155706464 18:28821573-28821595 GAAAGAAATAATAAAGATAATGG - Intergenic
1155843579 18:30677611-30677633 GAAAAGACTAACAAAGAGAAAGG + Intergenic
1155885191 18:31199060-31199082 GTGATGAATAATGATGTGAAAGG + Intergenic
1156129246 18:33949554-33949576 GAGAAGCATAATTAAGAAAAAGG + Intronic
1156488269 18:37480550-37480572 AAGATGAATGATAAGTAGAAAGG - Intronic
1156555563 18:38063775-38063797 AAGATGAGTAATAAACAGAAAGG + Intergenic
1158349456 18:56550216-56550238 AAGAAGAAAAATAAAAAGAATGG - Intergenic
1158580288 18:58674842-58674864 GAGAAGAAAAAGAAACAGAATGG - Intronic
1159341174 18:67135609-67135631 AAGATAAATAATAGAGAAAATGG - Intergenic
1159412442 18:68097382-68097404 TAGATGAATAATAAGGAAATTGG + Intergenic
1159516211 18:69461602-69461624 GAGATAAATAATATAAAGATTGG - Intronic
1159851063 18:73527762-73527784 GAGAAGAAAAATGGAGAGAAAGG - Intergenic
1161365527 19:3877194-3877216 TAGATGAATAAAAAAGAGGGAGG - Intergenic
1162102985 19:8351807-8351829 GAGAGGTATAAGAAAGAAAAGGG + Intronic
1162299950 19:9838810-9838832 CAGATGGAAAAGAAAGAGAATGG - Intronic
1163276090 19:16285230-16285252 AAGAGGAAGAAGAAAGAGAAGGG + Intergenic
1163462882 19:17449206-17449228 AAAATAAAAAATAAAGAGAAAGG + Intronic
1163504874 19:17699718-17699740 AAGAAGAAGAATAGAGAGAAAGG + Intergenic
1164063979 19:21698197-21698219 GAGTTGAATAATTAAAGGAAAGG + Intergenic
1164808407 19:31137038-31137060 GAGGTGAGAAAGAAAGAGAAGGG + Intergenic
1164912314 19:32022923-32022945 GAGTTGATTTATAAAGTGAAGGG - Intergenic
1165594318 19:36999248-36999270 GAAATGAGTAATAATGATAAGGG - Intergenic
1166029300 19:40114713-40114735 GAGATGAATAAGAAACAAAATGG - Intergenic
1166162058 19:40961483-40961505 TAGATGAATAATAATTGGAAAGG - Intergenic
1166259850 19:41630140-41630162 GAGATTAATAAGAAATGGAATGG - Intronic
1167081324 19:47277915-47277937 GAGATGAAAACCAAAGAGAGGGG - Intergenic
1168366946 19:55796471-55796493 GAGATGAATGCAAAAGAGGAAGG - Intronic
1168433585 19:56300966-56300988 GAGATGGATGAGAAAGAGAAAGG + Intronic
925334987 2:3090514-3090536 GAGATAAATGAAATAGAGAATGG + Intergenic
925576219 2:5363041-5363063 GAGGTGAATATAACAGAGAAAGG - Intergenic
926364884 2:12123930-12123952 GATGTGAATGATGAAGAGAAGGG + Intergenic
927093787 2:19732207-19732229 GAGATGAACAATCAGGTGAAAGG - Intergenic
927330777 2:21860897-21860919 GAGATCAATCATAAAATGAATGG - Intergenic
927374132 2:22393572-22393594 GAGATGAGCAAAAAGGAGAAGGG + Intergenic
927424566 2:22967866-22967888 GAAATGAACAAGAAAGAGGAAGG - Intergenic
929403827 2:41617163-41617185 GATTTGATTAATTAAGAGAACGG - Intergenic
929455753 2:42063841-42063863 GAGATAAGGAATAAAGAGTAAGG - Intergenic
929479983 2:42296424-42296446 GAGGTGAATGAACAAGAGAAAGG - Intronic
930135800 2:47904337-47904359 CAGCTAATTAATAAAGAGAATGG + Intronic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
930841485 2:55852024-55852046 GAGATTAGTAAGAAATAGAATGG - Intergenic
930852739 2:55978094-55978116 GAGATTGATAAGAAACAGAATGG + Intergenic
931078894 2:58746688-58746710 GAGTTGGATAATAAATATAAAGG + Intergenic
931868195 2:66433802-66433824 GAGCGGGAGAATAAAGAGAAGGG + Intronic
931917270 2:66969747-66969769 GAGAACAAAAATAAAGAAAAAGG + Intergenic
932028641 2:68160410-68160432 GAACTGAAGTATAAAGAGAAAGG - Intronic
932165117 2:69498663-69498685 GAGATGCATGATAAAGTGGAAGG + Intronic
932487980 2:72097208-72097230 ATGATGACGAATAAAGAGAAAGG - Intergenic
932536136 2:72597720-72597742 TAGATTAAAAATAAAGAGATGGG + Intronic
932570312 2:72935040-72935062 GAGGTGAAGAAGAAAGAGAGGGG - Intronic
932939478 2:76145768-76145790 AAGAAGAATAATACAGAGACAGG + Intergenic
933078522 2:77959304-77959326 CAGATCAATAAGAAAGAGTATGG - Intergenic
933129158 2:78651514-78651536 GAGAAGAACTATAAAGACAAGGG - Intergenic
933133749 2:78705012-78705034 GAGATCAATAAAAAATAGTATGG - Intergenic
933189858 2:79322568-79322590 GATCTGACTAGTAAAGAGAAAGG + Intronic
933358037 2:81239584-81239606 AAGAAGAATAATGCAGAGAAAGG - Intergenic
933461154 2:82587514-82587536 GATATGAGTAAGAAACAGAAGGG + Intergenic
933997791 2:87682627-87682649 GAAAAGAAAAAGAAAGAGAAAGG + Intergenic
934029908 2:88034099-88034121 GAGATGAATAAAGAGGTGAATGG + Intronic
934042750 2:88142747-88142769 GAGATGAAAAATAAACTGGATGG - Intergenic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
935497709 2:103802287-103802309 GGGATGATTTATAAAGAAAAAGG - Intergenic
935832096 2:107010872-107010894 AAGATGAAAAATAACAAGAAGGG + Intergenic
936339771 2:111620878-111620900 GAGATGAAAAAGAGAGAGAAAGG + Intergenic
936369530 2:111892065-111892087 GAGGTGAACAATAAAGTGGAAGG - Intergenic
936809479 2:116380069-116380091 GAGGTGTATAATAGAGAGGATGG - Intergenic
936896062 2:117428978-117429000 GAGAACCATAACAAAGAGAATGG + Intergenic
937606301 2:123805727-123805749 GGAAAGAATAATAAAGACAATGG + Intergenic
937662737 2:124449039-124449061 GAGATGAATAATTGAGAAATCGG + Intronic
938241362 2:129744689-129744711 TAAATGAATAATCAAGCGAATGG + Intergenic
938747949 2:134298396-134298418 GTGATAAATAATACAGAGATAGG - Intronic
939217255 2:139254469-139254491 GAAATCAATAACAAAGATAAAGG + Intergenic
939235166 2:139482082-139482104 GAGGGGAATAATTACGAGAAGGG - Intergenic
939390376 2:141561338-141561360 TAGATTAATATTACAGAGAAAGG + Intronic
939842828 2:147209063-147209085 GAGGAGAATAAGACAGAGAAAGG + Intergenic
939895799 2:147790087-147790109 GAGAAGAAAAATAAAGACAAAGG + Intergenic
940520346 2:154737661-154737683 GAGATGAAAAATAAACTGTATGG + Intronic
940521499 2:154756221-154756243 TAGATAAATAATAATGATAATGG + Intronic
941104715 2:161340193-161340215 TAGATGAAAAATAAGGGGAATGG + Intronic
941297160 2:163753807-163753829 GAGATGAAAAATACAATGAAAGG + Intergenic
941337062 2:164259473-164259495 GAAATAAATAATAAAGATAAGGG + Intergenic
941535434 2:166717517-166717539 AAGAAGAATAAGATAGAGAAAGG - Intergenic
942458709 2:176155065-176155087 GAGAGGAAAAAAGAAGAGAAGGG - Intronic
942548913 2:177093951-177093973 GTTATCAATAATAAAGAAAATGG - Intergenic
942604864 2:177679889-177679911 AAGATGAAAAATGAAGAAAAAGG + Intronic
942795633 2:179815423-179815445 GAGAAGAATGATAAAGATTATGG + Intronic
942825980 2:180177271-180177293 GAGAGGAAAAAACAAGAGAAAGG - Intergenic
942860665 2:180606937-180606959 TATAAGAAAAATAAAGAGAATGG - Intergenic
942909606 2:181227180-181227202 GAGAAGAATCAGAACGAGAAGGG + Intergenic
943153755 2:184147307-184147329 AAAATAAAAAATAAAGAGAATGG + Intergenic
943271808 2:185814852-185814874 CAAATGGATAATCAAGAGAATGG - Intronic
943299496 2:186180177-186180199 GAGATGGATAAAAAGGAGCAGGG - Intergenic
943657144 2:190521789-190521811 GAGAAGTATAATAAGGAGAAGGG - Intronic
943858489 2:192828857-192828879 GAGAGGAAGAGAAAAGAGAAAGG + Intergenic
944082413 2:195803085-195803107 GAAAATAATAATAAAGAAAAGGG - Intronic
944173683 2:196806123-196806145 TAGCTGAATAATAAAGGGAATGG - Intronic
945126762 2:206520492-206520514 GAAATGATTAACAAAGATAAAGG - Intronic
945257357 2:207813592-207813614 TAAATGAATAATAAAAACAAAGG + Intergenic
945273994 2:207970009-207970031 GAGAAGAAAGAAAAAGAGAAGGG - Intronic
945419606 2:209618170-209618192 GAGTTGAAAAATCAAGAGGAAGG + Intronic
945510088 2:210690490-210690512 GTGATAAAAAATAAAGAGACAGG + Intergenic
945650234 2:212549459-212549481 GAAATGAAGAATAAAGAAGATGG - Intergenic
946316507 2:218918161-218918183 GAGATGAATTATACACTGAAAGG - Intergenic
946588118 2:221213547-221213569 GTGATGAGGAATAGAGAGAAAGG - Intergenic
946798267 2:223380063-223380085 GAGATTAATAAGAAATGGAATGG + Intergenic
947675397 2:231974478-231974500 GAGATGAAAAATACACTGAATGG - Intronic
947678765 2:232010272-232010294 GAGATGAAAGATAGAGAGAAAGG - Intronic
947724828 2:232390554-232390576 GAGATGAAAAAGAAATGGAATGG + Intergenic
947730344 2:232425241-232425263 GAGATTAATAAGAAAGGGAATGG + Intergenic
947779724 2:232748060-232748082 AAGAGGTACAATAAAGAGAAAGG - Intronic
1169706356 20:8509701-8509723 CAGATGATTGATAAAGAGATAGG + Intronic
1171137139 20:22705796-22705818 GAGAGAAATAATAAAGATCAAGG - Intergenic
1171812697 20:29758016-29758038 GAGAAGTAGAATAAGGAGAAGGG + Intergenic
1172899535 20:38324384-38324406 GTGATGAATAAGAAACATAAGGG + Intronic
1173432568 20:43002843-43002865 GAGAGGCTTAATAAAGATAAAGG + Intronic
1173939739 20:46900329-46900351 GAGATGAATAGAAAAGAAAGGGG - Intronic
1174024751 20:47564729-47564751 GAAATGTAAAATAAAGAAAATGG - Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174201524 20:48809600-48809622 AAGAACAATAATAAAGACAATGG - Intronic
1174534049 20:51237183-51237205 AACATGCATAATAAAGAGGAGGG + Intergenic
1174651632 20:52130513-52130535 CAGATAAATAATAAGCAGAATGG - Intronic
1175398430 20:58684241-58684263 TAGATGTATAATAAACACAAGGG + Intronic
1176342461 21:5710858-5710880 GAAATAAATACTAAATAGAATGG - Intergenic
1176474715 21:7143010-7143032 GAAATAAATACTAAATAGAATGG - Intergenic
1176502366 21:7613598-7613620 GAAATAAATACTAAATAGAATGG + Intergenic
1176536782 21:8108927-8108949 GAAATAAATACTAAATAGAATGG - Intergenic
1176609764 21:8869826-8869848 CATATAAATAACAAAGAGAATGG + Intergenic
1176691429 21:9915633-9915655 AAAATGAACAATAAAGAGAAAGG - Intergenic
1176700250 21:10039096-10039118 AAAATGAATAAAAAAGAAAAAGG - Intergenic
1177118792 21:17116906-17116928 TAGATAAATAATTAAGAGACTGG - Intergenic
1177198175 21:17924519-17924541 GAGGTGAACAAGGAAGAGAAAGG + Intronic
1177566046 21:22821597-22821619 GACATGAAAAATAAAGAAAAGGG + Intergenic
1177753919 21:25321727-25321749 GAGATAAATGGAAAAGAGAAGGG - Intergenic
1177923225 21:27181059-27181081 TAAATAAATAATAAAGGGAATGG + Intergenic
1177968807 21:27762121-27762143 GAGATTATTAATATAGAGAAAGG - Intergenic
1178870297 21:36368334-36368356 GAGCTGAAGAATACAAAGAAGGG + Intronic
1179064002 21:38007156-38007178 GTGATGAGTACTACAGAGAAAGG + Intronic
1179085284 21:38210987-38211009 GAGATACAGAATAAAGAAAAAGG - Intronic
1180021735 21:45132879-45132901 TAGACGAAGAAGAAAGAGAAGGG + Intronic
1181425279 22:22833235-22833257 GAGCTGAAGAAGAAAGAGACAGG + Intronic
1182838979 22:33369299-33369321 GAGATTGATAAGAAATAGAATGG + Intronic
1183611547 22:38910474-38910496 GAGAAGAATGGTAAAGAGATAGG - Intergenic
1185252183 22:49809118-49809140 CAGAGGAAAAATAAAGAAAAAGG + Intronic
1203241729 22_KI270733v1_random:25334-25356 GAAATAAATACTAAATAGAATGG - Intergenic
949094678 3:72119-72141 CAGAGGAAGAATATAGAGAAAGG + Intergenic
949271667 3:2224496-2224518 CAGTTGAATAATAAGGGGAAAGG - Intronic
949286354 3:2410390-2410412 GAAATCAATAATAAAGACAATGG + Intronic
949794080 3:7826852-7826874 GAAATAAATAATAAAGATCAGGG + Intergenic
950657690 3:14447296-14447318 AAGATAGATAATAAAGAGGATGG - Intronic
951264583 3:20551260-20551282 GGGATCATTAATAAAGAGAAGGG - Intergenic
951742810 3:25943137-25943159 GAGCTGAAGGAAAAAGAGAAAGG + Intergenic
951856540 3:27203296-27203318 GAGCTGAATAGCAAAGGGAAAGG - Intronic
952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG + Intergenic
953177147 3:40562860-40562882 GAGAGGTCTAATAAAGAAAAAGG - Intronic
953402736 3:42640466-42640488 GATATGAATAATTAAGAAACAGG - Intronic
953500947 3:43433681-43433703 GAGATGTATAATTAAGCCAATGG + Intronic
953812511 3:46125734-46125756 GAGATAAATAAAAAAGAGAATGG + Intergenic
953820266 3:46202290-46202312 TAGATGAAGAACAAAAAGAAGGG + Exonic
954600684 3:51865462-51865484 GAGATTAATAAGAAACAGAGTGG + Intergenic
955069814 3:55562689-55562711 GAAATGAAAAAAAAAGAAAAGGG - Intronic
955608016 3:60727377-60727399 GAGATAAACAAGAAAGAGATAGG + Intronic
955679599 3:61486844-61486866 GTGAGGAATGATAAAGGGAAGGG + Intergenic
955916103 3:63910262-63910284 GAGAACAAAAATAAGGAGAATGG - Intronic
956056797 3:65307544-65307566 GAGAAGAGAAATAAAGAGGAAGG + Intergenic
956301070 3:67773387-67773409 GAGCTGAAGGATAAAGAGAAGGG + Intergenic
956307826 3:67845822-67845844 TAGAAGAATAATAAAGAGTTTGG - Intergenic
956802276 3:72770643-72770665 TAGATGAATACTAAAGACAAAGG + Intronic
957382521 3:79451037-79451059 GAATTGAAAAATAAAAAGAAAGG - Intronic
957444810 3:80302256-80302278 GATATGAATAATAATGAGAAAGG - Intergenic
957751013 3:84415639-84415661 GAGATAATTAGTATAGAGAAAGG + Intergenic
957756778 3:84499093-84499115 GAGATGAAAAAAAAAAAAAAAGG + Intergenic
958541201 3:95475801-95475823 GAGATTAATAAGAAATGGAATGG - Intergenic
958641104 3:96806125-96806147 GTGATGAATAAAACAGATAAAGG - Intergenic
958853458 3:99356327-99356349 AAAATGAATAATAAAGACAAAGG - Intergenic
959107215 3:102078190-102078212 GAGAACACTAATGAAGAGAAAGG - Intergenic
959227648 3:103605551-103605573 CAAATGAAAAAGAAAGAGAAAGG + Intergenic
959669465 3:108959591-108959613 GAGCTGAGTAAAAGAGAGAAGGG - Intronic
960300678 3:115999305-115999327 GAGGAGAATGATAAAGACAAGGG - Intronic
961004579 3:123396338-123396360 GAGAAGAAAAAGAGAGAGAAGGG + Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
962126171 3:132621090-132621112 GACATAAAGAATAAAGAGAGAGG + Intronic
962321020 3:134390301-134390323 GAGATAAATAATATGTAGAATGG - Intergenic
962607558 3:137045125-137045147 GAGATGTAGGATAAAGAGGAAGG + Intergenic
962735878 3:138324794-138324816 GTGATGAACCATGAAGAGAAGGG - Intronic
962850559 3:139305595-139305617 GAGATGGATAGTGCAGAGAAAGG + Intronic
963529479 3:146456063-146456085 GAGATGAATATTAAACAAATGGG + Intronic
963633156 3:147759385-147759407 AAGATCAATAAAGAAGAGAAAGG - Intergenic
963796774 3:149638595-149638617 GAGAGAAAAAAGAAAGAGAATGG - Intronic
964079315 3:152732719-152732741 GAGATGAATATGACAGAAAATGG - Intergenic
964121686 3:153191199-153191221 GAGATGAATTCTAAAGTGCAAGG - Intergenic
964133375 3:153316060-153316082 GAGAAGAATAACAAATACAATGG - Intergenic
964280204 3:155055702-155055724 GAGATGGATAATGACTAGAAAGG + Intronic
964316804 3:155453616-155453638 GAACTGATTAATGAAGAGAATGG + Intronic
964781408 3:160342556-160342578 TACAGGAATAGTAAAGAGAAGGG - Intronic
964840894 3:160992590-160992612 GAGCTGAGTAAGGAAGAGAAAGG - Intronic
965050446 3:163640497-163640519 GACATCAAGAATAAAGAAAAAGG + Intergenic
965092886 3:164183974-164183996 AACATGAATAATAAAGATAATGG - Intergenic
965230387 3:166043690-166043712 GAGAAATATAATAAAGAGGAGGG + Intergenic
965237499 3:166144513-166144535 GCCCTGAAGAATAAAGAGAAAGG + Intergenic
965311813 3:167137395-167137417 GAGATGAAAAATATAGTGGATGG + Intergenic
965704964 3:171496997-171497019 TAGATAAACAATAAAAAGAAAGG - Intergenic
966470914 3:180287945-180287967 GAGAAGAGAAAGAAAGAGAAAGG - Intergenic
966755304 3:183364549-183364571 GAAATGAATAAGGTAGAGAATGG + Intronic
967627767 3:191705560-191705582 CAGACAAATAAGAAAGAGAAAGG + Intergenic
967843233 3:194023936-194023958 GAGATTTATAAAAAAGAAAAGGG + Intergenic
967874695 3:194259889-194259911 GAGTTGAATAATTGAGAGAGGGG - Intergenic
968321505 3:197772989-197773011 AAGACCAAAAATAAAGAGAAAGG - Intronic
969324717 4:6435568-6435590 GAGATGAGTAATAATTAGTAAGG - Intronic
970050298 4:11906619-11906641 GAGAAAAATAAGAAAGAAAAGGG + Intergenic
970284151 4:14490698-14490720 AAAATTAATAATAAACAGAATGG + Intergenic
970336776 4:15054871-15054893 GAAATGAATAAAAAAAAGAGGGG + Intronic
970564474 4:17318353-17318375 GAAATGAAGGAGAAAGAGAATGG - Intergenic
970682114 4:18521522-18521544 GAGATAAATAATCAAAATAAAGG + Intergenic
970803089 4:19999560-19999582 GAGAGGAAAAAAAAAGAGAGTGG + Intergenic
971026706 4:22595673-22595695 GAGAAGAATATTCAAGAGAGAGG - Intergenic
972417987 4:38861502-38861524 CAGAAGAATAATGAAGAGGATGG - Intergenic
972630384 4:40836838-40836860 GAGAAGAGTAAAAAACAGAAAGG - Intronic
973038571 4:45441315-45441337 GAGATCATTAATAAAAAGATGGG - Intergenic
973167982 4:47101574-47101596 AAGATTAGAAATAAAGAGAATGG + Intronic
973249860 4:48049548-48049570 GAGAACAATGATACAGAGAAGGG + Intergenic
974172682 4:58287468-58287490 GAGATGAATATTAAAATGATAGG - Intergenic
974363371 4:60913012-60913034 CAGATGAATACTAAAGATAAAGG + Intergenic
974366219 4:60953208-60953230 AAGAAGAAAAATAAAAAGAATGG - Intergenic
974383621 4:61175772-61175794 CAGTTGAATAAGTAAGAGAAAGG + Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974567480 4:63596159-63596181 GAAATGATTAAGAAAAAGAATGG + Intergenic
974988576 4:69058982-69059004 GAGAATAATAATAAGGAGAAGGG + Intronic
975413527 4:74082480-74082502 TATATAAATAATAAAGAAAAAGG - Intergenic
975497119 4:75047035-75047057 GAGCTGAGTTATAGAGAGAAAGG + Exonic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
976617635 4:87094473-87094495 GAGTTGAATAATGAAGGGACAGG + Intronic
976783256 4:88785936-88785958 GAGAAGAACAATTAAGGGAAAGG + Intronic
976937201 4:90651109-90651131 GAGTGGATTAATGAAGAGAAAGG - Intronic
977056322 4:92197335-92197357 TAAAGAAATAATAAAGAGAAGGG - Intergenic
977239524 4:94550197-94550219 GAGAAGAATATTTAAGACAAGGG - Intronic
977451169 4:97200139-97200161 TAAATGAATAATAGAGAAAAAGG + Intronic
977476724 4:97519829-97519851 GAGATGAAGAAAAAGGAGAAAGG + Intronic
977542549 4:98335140-98335162 GAGATTAATAAGAAAAGGAATGG - Intronic
978038967 4:104034481-104034503 AAGATAAATATTATAGAGAATGG + Intergenic
978181551 4:105803154-105803176 GAGATGAAAAATATTGTGAAAGG - Intronic
978225241 4:106325866-106325888 GAGAAGAGAAATAAAAAGAAAGG + Intronic
978508746 4:109492078-109492100 GAGATAAGAAATAAAAAGAAGGG - Intronic
978928812 4:114285939-114285961 GAAATTAATAAAAAATAGAAAGG + Intergenic
978968201 4:114768829-114768851 GATATGAATAATAAATTCAATGG + Intergenic
979572482 4:122244571-122244593 AACATGAATAAAAATGAGAATGG + Intronic
979607118 4:122650323-122650345 GAGAGGTATGATAAGGAGAAAGG + Intergenic
979796170 4:124849502-124849524 GACAAGAATAATAAAGCAAAGGG + Intergenic
979966233 4:127079233-127079255 GAGATGGAGCATGAAGAGAAAGG - Intergenic
980086523 4:128396355-128396377 AAGATGAATAAGGAAGGGAAGGG - Intergenic
980298115 4:130949699-130949721 AATATGAAAAATAAAGAGGAGGG + Intergenic
980364012 4:131775827-131775849 AAAATGAACAATAAAGAGAAAGG - Intergenic
980372656 4:131897858-131897880 AAAATGAATAAAAAAGAAAAAGG - Intergenic
980384282 4:132066466-132066488 GAGATGAAAAAGAAAGAGAGAGG + Intergenic
980728285 4:136793920-136793942 TACATGAATAAGAAAGACAAAGG + Intergenic
981629140 4:146798068-146798090 AAGATGAAAAATAAATTGAATGG - Intronic
982417508 4:155153332-155153354 GAGATTAATAAGAAACAAAATGG + Intergenic
982874553 4:160629529-160629551 TACATGAAAGATAAAGAGAAAGG + Intergenic
982909992 4:161127967-161127989 GAAATGAAGAAGAAAGTGAATGG - Intergenic
983303366 4:165955886-165955908 CAGCTGAGAAATAAAGAGAAAGG + Intronic
983437728 4:167736402-167736424 GAGATAAATAAAATAGAAAACGG - Intergenic
983998768 4:174216223-174216245 GAGTTGAATGAAAAAAAGAAGGG + Intergenic
984198431 4:176688353-176688375 GAGATGAATAAAATAAATAATGG - Intronic
984207778 4:176806806-176806828 GAGAGAAGGAATAAAGAGAATGG + Intergenic
984409819 4:179382703-179382725 TAGATGAATAATGATGAGACTGG + Intergenic
984890846 4:184491331-184491353 GAGATGAATTCTATAGAAAAAGG - Intergenic
985100068 4:186450096-186450118 GTGATGAAAAATACTGAGAAGGG - Intronic
985216664 4:187660730-187660752 GAGATAAATAATGTGGAGAAAGG - Intergenic
985346198 4:189007440-189007462 AATCTGGATAATAAAGAGAAAGG + Intergenic
985362931 4:189194458-189194480 AGAATGAAAAATAAAGAGAATGG - Intergenic
986457923 5:7938962-7938984 GAGATGGGTAATAAACAGAAAGG + Intergenic
986618297 5:9643028-9643050 GAGAGGAAGGATAAAGAGGAAGG - Intronic
987560169 5:19509851-19509873 GAGAAAAATATTAAAAAGAAAGG - Intronic
987669831 5:20991550-20991572 AAGATGAAAAAAAAAGGGAAAGG + Intergenic
987954531 5:24721350-24721372 GAGATGATGATTAAAGAGAAAGG - Intergenic
988045927 5:25952789-25952811 GAGATGTATAATTAATAGCATGG - Intergenic
988053949 5:26068077-26068099 GAGATGAAGGAAAAAGAGAAGGG + Intergenic
988164738 5:27572067-27572089 GAGAAGAAAGATAAAGAGGAGGG + Intergenic
988177887 5:27750688-27750710 GAGCTCAAAAATAAAGAGGAAGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988946659 5:36209794-36209816 AAGATGAATAACAAAGATAGTGG - Intronic
988950168 5:36248163-36248185 GAGATGAAGAAAAGATAGAAGGG - Intergenic
989187654 5:38640943-38640965 GAGTTCATTTATAAAGAGAAAGG + Intergenic
989783036 5:45292688-45292710 GAGAATAATATTAAAGTGAATGG + Intronic
989815989 5:45738087-45738109 GAAATGAATAAAGGAGAGAAAGG + Intergenic
989817655 5:45756178-45756200 GTGATAAAGAGTAAAGAGAAAGG + Intergenic
990042679 5:51391567-51391589 GAGGTGGGTAATGAAGAGAAGGG + Intronic
990066096 5:51716630-51716652 GAAATCAAGAATAAAGAAAAAGG + Intergenic
990211871 5:53489374-53489396 TACATGAATGATAAAGAAAATGG + Intergenic
990690771 5:58361281-58361303 GAGCTGATTAATCAAGAGAATGG - Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
991704525 5:69345448-69345470 TAGATTAACAAAAAAGAGAAGGG - Intergenic
992286283 5:75238573-75238595 GAGTTGGATAATTAAAAGAATGG - Intergenic
992467595 5:77022481-77022503 GAGAAGAAGAAGAAAGAGAAGGG + Intergenic
992485203 5:77188268-77188290 GAGATGAATAATATTGATAAAGG + Intergenic
993521056 5:88901096-88901118 GGGATCAATAAGAAAAAGAAAGG + Intronic
993653263 5:90547812-90547834 GTGATTATTAATAAATAGAAAGG + Intronic
994474823 5:100253461-100253483 GAGAGGATTTATTAAGAGAAGGG - Intergenic
994666104 5:102707521-102707543 GAGATCAATGAAAAAGAGAAAGG + Intergenic
995061922 5:107820404-107820426 GACATGAAGAAAGAAGAGAATGG + Intergenic
995426862 5:112034189-112034211 GAGATAAATAGAAAGGAGAAAGG + Intergenic
995542363 5:113197570-113197592 GAGGTGAAAATTAAAGAGATTGG - Intronic
995670409 5:114596716-114596738 GAAAAAAATAAGAAAGAGAAGGG + Intergenic
995687593 5:114787911-114787933 AAGAGGAACAATAATGAGAACGG + Intergenic
996045800 5:118872528-118872550 GAGAAGAGGAAGAAAGAGAAAGG + Intronic
996168395 5:120256243-120256265 GAGATACAAAATTAAGAGAAAGG - Intergenic
996233089 5:121090316-121090338 GATAGTAAGAATAAAGAGAAAGG - Intergenic
996705170 5:126490640-126490662 CAGATGAATCAAAAAGAGCACGG - Intronic
996893579 5:128453675-128453697 GAGATGAATAATAAAGAGAAAGG - Intronic
997287639 5:132693260-132693282 GAGATGAGTAATCAAGGGAAGGG - Exonic
997735233 5:136208230-136208252 GAGATGAGAAATAGAGACAAGGG - Intergenic
997784507 5:136697018-136697040 GAGATTAATAAGGAACAGAATGG - Intergenic
998080573 5:139271996-139272018 GAGATGGAGGATAAAGAGAAAGG + Intronic
999835734 5:155368909-155368931 TAGATGAGTAACAAATAGAAAGG - Intergenic
1000679623 5:164167230-164167252 GAAATGAAAATTAAAGAAAAAGG + Intergenic
1000742815 5:164991343-164991365 TATATGAAGCATAAAGAGAATGG - Intergenic
1000805165 5:165781584-165781606 AAGATGAATGATAAAGGCAAAGG - Intergenic
1000886315 5:166751651-166751673 AAGAAGAATAATTAAGACAAAGG - Intergenic
1001478285 5:172066475-172066497 GGGATGAATCCCAAAGAGAAGGG + Intronic
1001918678 5:175583305-175583327 GAGAGGAATAAGAGAGAGAGTGG + Intergenic
1002039876 5:176505123-176505145 GAGATGTATCAAAAAGAAAATGG + Intronic
1002396834 5:178963822-178963844 CAGATGAATAATAAAAAGCTAGG - Intronic
1002545512 5:179940873-179940895 GAGAAGAAAAATACAGAAAAAGG - Intronic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1003102681 6:3188957-3188979 GAAATGATAAATAGAGAGAAGGG + Intergenic
1003360157 6:5418013-5418035 GAGATGAAAAATACACAGGAAGG - Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004705496 6:18120870-18120892 GAGATTAATAATAAAAATTATGG + Intergenic
1005945161 6:30590002-30590024 GACATGAATGATAAGGTGAAGGG - Intronic
1006584337 6:35096731-35096753 GAGATTAATAAGAAATGGAATGG + Intergenic
1007142837 6:39593332-39593354 AATAAGAATAATAAAGAGAGTGG - Intronic
1008153011 6:47978109-47978131 GAGAAGAAAAATAATGAGAAGGG - Intronic
1008815073 6:55555396-55555418 TAGAAGCATAATAAAGAGTAAGG - Intronic
1009674448 6:66799447-66799469 AAGATGAAGAAAAAAGAGTAAGG - Intergenic
1009733440 6:67641289-67641311 GGGTTAAATAATAAAAAGAAAGG - Intergenic
1009938715 6:70264173-70264195 TAAATGAAAAATAAAGATAAGGG - Intronic
1010020356 6:71152634-71152656 GAGTGGATTAATAAAGAGAGTGG - Intergenic
1010290178 6:74127054-74127076 GAGAGGAGTGATATAGAGAATGG + Intergenic
1010337466 6:74703720-74703742 GAGTTGGTTCATAAAGAGAAAGG - Intergenic
1010423133 6:75696776-75696798 GAGAGGAATTATAAAGAAAAAGG - Intronic
1010846360 6:80713618-80713640 AAGATGAACAATGGAGAGAAGGG + Intergenic
1010892024 6:81325042-81325064 GGGGTGAATAAAAAGGAGAAGGG - Intergenic
1011198677 6:84810009-84810031 GATATGCATAAAAAAGAAAATGG - Intergenic
1011617552 6:89211002-89211024 CAGAGAAATAAGAAAGAGAATGG + Intronic
1011917650 6:92528274-92528296 TGCATGAATAAGAAAGAGAAAGG + Intergenic
1012782350 6:103578788-103578810 GAGGTGGAAAATATAGAGAAAGG + Intergenic
1012902110 6:105018559-105018581 GAAATGAATAATACAAAGGAGGG - Intronic
1012973453 6:105755428-105755450 TAAATGAATAATTGAGAGAAAGG + Intergenic
1013051912 6:106544352-106544374 GAGTTGTATAAAAAAGGGAAGGG - Intronic
1013333189 6:109127330-109127352 GAGATGGAGAAAAAAGAAAAGGG - Intronic
1013436368 6:110113028-110113050 GAGAAAGATAATGAAGAGAATGG + Intronic
1014570667 6:123003855-123003877 GAAATGAATAATGAATAAAATGG - Intronic
1014956992 6:127632282-127632304 GAGATGAATAAATCAGAGACGGG - Intergenic
1015145757 6:129984590-129984612 GAGAGGAACAAAAAAGAGGATGG + Intergenic
1015203133 6:130604416-130604438 AAGATGAATCAGAAAAAGAAAGG - Intergenic
1015496200 6:133886002-133886024 GAAATGAAGAAAAAAGAGAATGG + Intergenic
1015715559 6:136188826-136188848 CACACCAATAATAAAGAGAAAGG + Intronic
1016176141 6:141079969-141079991 GAGATTAACAAAGAAGAGAAAGG + Intergenic
1016247226 6:141996820-141996842 CACATGAATAAAGAAGAGAAAGG + Intergenic
1017201285 6:151757355-151757377 GAGATGAGTAATAAAAAGATTGG - Intronic
1017245982 6:152225358-152225380 GAGATAAATAATTATGAGGAAGG - Intronic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017354001 6:153480685-153480707 GAGATAAATCATAAATATAAGGG + Intergenic
1017569027 6:155722414-155722436 AAGATGAATAATTAAGAAATGGG + Intergenic
1017880011 6:158555732-158555754 GAGATTAATAAAAAGCAGAATGG - Intronic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018268340 6:162050467-162050489 GAGATGAAAAAAAAAGAGAGGGG - Intronic
1018763942 6:166915062-166915084 GAGATTAATAAGAAATGGAATGG + Intronic
1019214167 6:170432341-170432363 GAGATTAATAAGAAACGGAATGG - Intergenic
1020763921 7:12298066-12298088 CAGATTAATAATAAAAAAAAAGG - Intergenic
1020851135 7:13353885-13353907 GGGATGATTAAAAATGAGAAGGG + Intergenic
1021477719 7:21081454-21081476 GAGATAAATATTTAAGATAATGG - Intergenic
1021656535 7:22879634-22879656 GAGAGGAATAAGAAAGGGAAGGG + Intergenic
1022024678 7:26436266-26436288 GAGAAGAATAAGACAGACAAAGG + Intergenic
1022090226 7:27103252-27103274 GAGAGGGAGAATAAAGAGAGAGG + Intergenic
1022123391 7:27332118-27332140 GAGATGAAAAATATACTGAATGG - Intergenic
1022419183 7:30204688-30204710 GAGAGAAAACATAAAGAGAATGG - Intergenic
1022668200 7:32430631-32430653 CAGATGGATAATAATAAGAAGGG - Intergenic
1023155042 7:37241389-37241411 GAGATGTACTATAAAGACAAGGG - Intronic
1023363692 7:39441940-39441962 GAAATAAAATATAAAGAGAAGGG + Intronic
1023474935 7:40566897-40566919 CAGATGAATAACAAAAAGGAAGG - Intronic
1023682779 7:42704785-42704807 GAGATAAATAATTTAGACAAGGG + Intergenic
1024921969 7:54567095-54567117 GACATAAATAAAAAACAGAAAGG + Intronic
1025221217 7:57109995-57110017 AAGATAACTAATAAAGAAAATGG - Intergenic
1025632030 7:63281804-63281826 AAGATAACTAATAAAGAAAATGG - Intergenic
1025650554 7:63464576-63464598 AAGATAATTAATAAAGAAAATGG + Intergenic
1026094896 7:67338905-67338927 GGGATCAATAAGAAAAAGAAAGG - Intergenic
1026144327 7:67733089-67733111 AAGATGATTAATAAATAGATAGG - Intergenic
1026407636 7:70083991-70084013 GAAAGGAATTACAAAGAGAAAGG - Intronic
1026871585 7:73856005-73856027 GTGCTGAGTAAGAAAGAGAAGGG + Intergenic
1028097773 7:86783632-86783654 GAGGTGGATGAGAAAGAGAAAGG + Intronic
1028528999 7:91817499-91817521 AAGCTGAGTAATTAAGAGAAGGG + Intronic
1028844377 7:95462907-95462929 AAGGTGAATGAGAAAGAGAAAGG + Intergenic
1029089300 7:98035608-98035630 GAAAAGAAAAAGAAAGAGAAGGG + Intergenic
1029431136 7:100531412-100531434 GAGATGAAAAGTACAGTGAATGG - Intergenic
1029925677 7:104313908-104313930 GAGAACAAAAATACAGAGAAGGG + Intergenic
1030026736 7:105331519-105331541 GAGATGAATAGTAAACTTAAAGG + Intronic
1030172775 7:106620649-106620671 TATATGTTTAATAAAGAGAAGGG + Intergenic
1030347029 7:108445934-108445956 GAAATGAAAAATGAAGAGACTGG - Intronic
1031251206 7:119383677-119383699 GAGATGAATATTAAATAAAAAGG - Intergenic
1031270177 7:119639082-119639104 GAGCAGACTAATAAAGAGTAAGG - Intergenic
1031419539 7:121533803-121533825 GTAATGAATAATAAAGATAGGGG - Intergenic
1031421323 7:121555371-121555393 AAGATGAATAATGAAAACAAGGG - Intergenic
1031504052 7:122559212-122559234 GGGATGAAAAATAAAGATATGGG + Intronic
1031947218 7:127854755-127854777 CACAGGAATTATAAAGAGAAGGG - Intronic
1033710003 7:143933311-143933333 GAGATGAAGAATAAAAAGACTGG - Intergenic
1034004380 7:147453003-147453025 GAAAGGAAGAAAAAAGAGAAAGG + Intronic
1034346472 7:150388389-150388411 GAGAAGCAGAAGAAAGAGAATGG - Intronic
1034750474 7:153563713-153563735 CACATGAATAATAAAATGAATGG + Intergenic
1034852439 7:154507493-154507515 GAGATGGAAAATACAGAGAAGGG + Intronic
1035987255 8:4448091-4448113 GAGATCAAGAACATAGAGAAGGG - Intronic
1036177679 8:6554790-6554812 TAGATGAATTGCAAAGAGAAAGG + Intronic
1036713993 8:11103239-11103261 GAGATGAACAAAAAAGACACAGG + Intronic
1037083737 8:14819864-14819886 TACACAAATAATAAAGAGAAAGG + Intronic
1037143189 8:15541567-15541589 CAGACTAAGAATAAAGAGAAAGG - Intronic
1038243990 8:25837167-25837189 ATGATGAATAATACACAGAAAGG - Intergenic
1039135076 8:34312831-34312853 GAAATGAATAATATTGGGAAAGG - Intergenic
1039789854 8:40866637-40866659 TTGATGAATAATTAAGAGGAGGG + Intronic
1039845479 8:41322533-41322555 CAGAAGGATAAGAAAGAGAAAGG + Intergenic
1039851199 8:41366843-41366865 TAGATGAAAAATTAAGAGACTGG + Intergenic
1040001623 8:42581861-42581883 GAGATGTACAGGAAAGAGAATGG - Intergenic
1040481900 8:47834195-47834217 GAGGTGGATAACAAAGTGAAAGG - Exonic
1040931721 8:52742225-52742247 GAGATTAAAAATATAGAGACTGG + Intronic
1040932932 8:52754152-52754174 GAGATTAATAAGAAACAGAATGG - Intergenic
1041490889 8:58431871-58431893 GAAAAGAATAATACAGATAATGG - Intronic
1041699506 8:60772730-60772752 GTGATGAAGAAAAGAGAGAAGGG + Intronic
1042263358 8:66883259-66883281 GAGAGGAATAATAAGCAGAATGG - Intronic
1042373315 8:68018090-68018112 GAGATGGAAGATTAAGAGAATGG + Intronic
1042652212 8:71055507-71055529 GAGATTAATGAGAAAAAGAAGGG + Intergenic
1042688889 8:71474216-71474238 AAGATGAAGAAGAAAGAAAAAGG + Intronic
1042696757 8:71562110-71562132 TGGATGAATAATTAAGAGCAGGG + Intronic
1043108395 8:76146077-76146099 GAGATGAATAAGGAGGAGAGTGG + Intergenic
1043169269 8:76944279-76944301 GACACAAATAAGAAAGAGAAAGG - Intergenic
1043522627 8:81063005-81063027 AAGATGATGAAAAAAGAGAAAGG + Intronic
1043672275 8:82901893-82901915 GAGAATAATAATTAAGAGTATGG + Intergenic
1043917919 8:85945406-85945428 GACATGAAGGATAAAGAGAAGGG + Intergenic
1044598857 8:93984002-93984024 CAGATGAATAATCAAGCGCAGGG - Intergenic
1044664367 8:94620699-94620721 AAGAAGAAAAATCAAGAGAAAGG - Intergenic
1044731250 8:95230246-95230268 GGAATGAATAATAAAGAGAGGGG + Intergenic
1044758149 8:95488675-95488697 GTGATGAAGAATTGAGAGAAAGG + Intergenic
1044768895 8:95608305-95608327 GAAATGAAAGACAAAGAGAAGGG + Intergenic
1045032481 8:98150850-98150872 GAAATAAATAACAAACAGAAGGG - Intronic
1045310872 8:101001431-101001453 AAGAGGAAGAATAAAGGGAAAGG - Intergenic
1045392108 8:101725877-101725899 GAGAAGAGTAAAGAAGAGAAGGG + Intronic
1045392652 8:101730958-101730980 GAGAAGAGTAAAGAAGAGAAGGG + Intronic
1045614050 8:103885549-103885571 GAGATGAATACGAAAGGCAAAGG + Exonic
1045856506 8:106770752-106770774 GAGTTGAATGAAAAAGAAAAAGG - Intergenic
1046058440 8:109107081-109107103 CAGTTGTATAATAAAGAGAATGG + Intronic
1046104768 8:109652301-109652323 GAGAGGAACAATAAAGAGAAAGG - Intronic
1046275071 8:111948441-111948463 GGGAAAAAAAATAAAGAGAAAGG + Intergenic
1046297336 8:112237765-112237787 AAGAGGAATAGCAAAGAGAAAGG + Intronic
1046698267 8:117368744-117368766 GAGATGAACAAATAATAGAAAGG - Intergenic
1046710646 8:117507259-117507281 GAGATAAATAAATCAGAGAAAGG - Intergenic
1046758110 8:117992146-117992168 GAGATGAAAACTCCAGAGAAAGG - Intronic
1046764528 8:118055460-118055482 GAGGTGGATTTTAAAGAGAATGG - Intronic
1046918519 8:119702722-119702744 GAGAAGAAGAAGAAAGGGAAAGG - Intergenic
1048357822 8:133667782-133667804 GAGGTGAAAAACAAAGGGAAGGG - Intergenic
1048739497 8:137538827-137538849 GAGAAGAAAAATAAAGATGAGGG + Intergenic
1048747863 8:137635360-137635382 AAGGTTAATAATAAAGAGATAGG - Intergenic
1048782739 8:138019969-138019991 GAGATGATGAAGAAAGAGAGAGG - Intergenic
1048911348 8:139138351-139138373 GAGATGGAGAATCAAGAAAATGG + Intergenic
1050722333 9:8604823-8604845 GAGATGGAAAATATAGAAAATGG + Intronic
1051122747 9:13769657-13769679 GAGAGGAAGCATAAAGAAAAGGG - Intergenic
1051237382 9:15015803-15015825 GAGAATAATAATGAAAAGAATGG - Intergenic
1051325717 9:15965671-15965693 GAGAAGAGTGAAAAAGAGAAGGG + Intronic
1052009718 9:23392285-23392307 TATATGAAAGATAAAGAGAAAGG + Intergenic
1052235138 9:26204107-26204129 GAAATCAATAATAAAAGGAAAGG - Intergenic
1052505372 9:29346999-29347021 GAGAAGAGAAATAAAGAGAGAGG - Intergenic
1052599521 9:30606593-30606615 GAGATGATAAAAGAAGAGAAAGG - Intergenic
1053348518 9:37395715-37395737 GAGATTAATAATAAAAGGCAGGG - Intergenic
1053465036 9:38300143-38300165 TTGCTGAATAATAAAAAGAATGG - Intergenic
1053628361 9:39901710-39901732 AAAATGAACAATAAAGAGAAAGG - Intergenic
1053637446 9:40025904-40025926 AAAATGAATAAAAAAGAAAAAGG - Intergenic
1053768633 9:41439337-41439359 AAAATGAATAAAAAAGAAAAAGG + Intergenic
1053777697 9:41564619-41564641 AAAATGAACAATAAAGAGAAAGG + Intergenic
1054215526 9:62348991-62349013 AAAATGAACAATAAAGAGAAAGG + Intergenic
1054318228 9:63622470-63622492 AAAATGAATAAAAAAGAAAAAGG - Intergenic
1054364356 9:64317808-64317830 AAAATGAACAATAAAGAGAAAGG - Intergenic
1054547303 9:66350817-66350839 AAAATGAATAAAAAAGAAAAAGG + Intergenic
1054671955 9:67806356-67806378 AAAATGAACAATAAAGAGAAAGG - Intergenic
1054956201 9:70913451-70913473 GAGATAGATATTAAACAGAAAGG + Intronic
1054997084 9:71404426-71404448 GAGATGAATAAGTTAGAGGAAGG - Intronic
1055381267 9:75709388-75709410 GAGATGAAAAATGCATAGAATGG - Intergenic
1055398637 9:75899775-75899797 GAGATGAAGCATGAAGAGAGGGG + Intronic
1055424953 9:76185144-76185166 GAGAGAAATAATAAAGATAAGGG - Intronic
1055589912 9:77801580-77801602 CAGTTGAATAATAGAGAGAAAGG + Intronic
1055744284 9:79425937-79425959 TAGATGAAAAATAAAAAGGAAGG - Intergenic
1056361414 9:85861383-85861405 GATCTGAAAAATAAACAGAAGGG + Intergenic
1056520462 9:87396459-87396481 TAAATGAATGATACAGAGAATGG + Intergenic
1056746176 9:89305464-89305486 GAGAGAAAAAATAAACAGAAGGG - Intergenic
1057001610 9:91514878-91514900 GAGATACAGAATAAAGAGAAAGG + Intergenic
1057734850 9:97646888-97646910 CATTTGAATAAAAAAGAGAAAGG - Intronic
1058088210 9:100774031-100774053 GAGATGAAGGAGAAAGGGAAAGG - Intergenic
1059083292 9:111273099-111273121 GAGATGAATAAATAAGAAATGGG + Intergenic
1059257016 9:112940079-112940101 GACCAGAATAATAAAGATAACGG + Intergenic
1059903545 9:118955633-118955655 GAGAGAAACAATAAAGAAAATGG + Intergenic
1060713413 9:125893858-125893880 TAGAACAATAATAAAGAGAAAGG + Intronic
1061458876 9:130720261-130720283 GAGAAGAATAACATAGAGAAGGG + Intronic
1061740342 9:132699185-132699207 GAGATTGATAAGAAATAGAATGG + Intergenic
1202785260 9_KI270719v1_random:9159-9181 AAAATGAATAAAAAAGAAAAAGG - Intergenic
1203458052 Un_GL000220v1:8408-8430 GAAATAAATACTAAATAGAATGG - Intergenic
1185490937 X:516532-516554 GAGAGGAATGAAACAGAGAAAGG - Intergenic
1185492356 X:527294-527316 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492386 X:527621-527643 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492393 X:527688-527710 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492400 X:527755-527777 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492407 X:527822-527844 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492414 X:527889-527911 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492421 X:527956-527978 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492428 X:528023-528045 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492435 X:528090-528112 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492446 X:528189-528211 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492459 X:528323-528345 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1185492472 X:528457-528479 GAGAAGAAAGAAAAAGAGAAAGG - Intergenic
1186109067 X:6236838-6236860 GTAATGAATGACAAAGAGAAGGG + Intergenic
1186183778 X:6998896-6998918 CAGATGAATAAGTAGGAGAAAGG + Intergenic
1186428287 X:9482846-9482868 GAAATGAATAATTAAGAGAAAGG - Intronic
1186511383 X:10132436-10132458 GAGATTCAGAATAAAGAGCAAGG + Intronic
1186724672 X:12344521-12344543 ATGGTGAATAATAAAGAAAACGG - Intronic
1187730367 X:22246896-22246918 GAGTTGAGTAAGAAATAGAAGGG + Intronic
1187958425 X:24543959-24543981 AAGATAAATAATAAGCAGAAGGG - Intergenic
1188168779 X:26894636-26894658 CACATAAATAAGAAAGAGAAAGG + Intergenic
1188334300 X:28910675-28910697 TAGATGACTAATATAGATAATGG + Intronic
1188417331 X:29951620-29951642 GAGATTATTAGTAAAGATAAGGG + Intronic
1188832735 X:34920187-34920209 GATATAAATAATAAACATAAGGG + Intergenic
1188885431 X:35544294-35544316 TATATAAAAAATAAAGAGAAAGG - Intergenic
1189164502 X:38847178-38847200 AAGATGAATAGGAAAGAGACAGG + Intergenic
1189238128 X:39504361-39504383 GAGATGAAAAAGGAAGGGAAAGG - Intergenic
1189550412 X:42086887-42086909 GATATGAAGAATTAAGAGAGAGG - Intergenic
1189604714 X:42664510-42664532 GAGAGGAATAAGAAACAGGAAGG + Intergenic
1190187534 X:48249217-48249239 AAGAAAAATAATAAAGAAAATGG + Intronic
1190466786 X:50732442-50732464 GAAATTAATAAAACAGAGAATGG + Intronic
1190579745 X:51880894-51880916 GAGAGGGATAAAAAAGAGGAAGG - Intronic
1191196875 X:57733518-57733540 AAGAGAACTAATAAAGAGAAAGG + Intergenic
1192774997 X:74234762-74234784 GAGGTGCATGATAAACAGAATGG + Intergenic
1192978227 X:76309555-76309577 AAGATGAATAATGTAGAGCATGG - Intergenic
1193445501 X:81596874-81596896 GAGATAAATAATAACCAGGATGG + Intergenic
1193543408 X:82798577-82798599 AAGATGAATGATAAATAGTAGGG - Intergenic
1193791425 X:85819895-85819917 CACATGACTGATAAAGAGAAGGG - Intergenic
1194404519 X:93478096-93478118 GAAATTAATAAAATAGAGAAAGG + Intergenic
1195584225 X:106545354-106545376 GAGAGAAATAATAAAGATAATGG + Intergenic
1197272278 X:124437797-124437819 GAGATACATAACAAAGAGCAGGG - Intronic
1197565796 X:128084395-128084417 GAGAAGAAACATAAAGATAAAGG + Intergenic
1198033166 X:132774988-132775010 GAGATGGATCATGAAGAAAACGG - Intronic
1198466877 X:136911267-136911289 GAAATAAAGAATAAAGAGCAAGG - Intergenic
1198657498 X:138930947-138930969 GAAATGAAAAATGAACAGAAAGG + Intronic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1198865182 X:141114834-141114856 GAAATGAAAAATAAACTGAATGG + Intergenic
1198981098 X:142397489-142397511 AAGATGAAAAATAGAGACAAAGG - Intergenic
1199000729 X:142633007-142633029 GAGATGAATCTTAAAGGGTATGG + Intergenic
1199293516 X:146131561-146131583 GAGGTGAAAAAGAGAGAGAAAGG + Intergenic
1199919893 X:152388913-152388935 GAGATGAAAAAGGAAAAGAATGG + Intronic
1200375474 X:155775211-155775233 GAGAGGAATAAAGAAGAGAAGGG - Exonic
1201749070 Y:17412990-17413012 GAGATGATTCATTAAGACAAGGG - Intergenic
1202084640 Y:21123327-21123349 GAGATGAATATTCAAGAAAAGGG - Intergenic